Summary
Transcript IDgene_000012883
Gene IDTTHERM_01289140
Length617 bp
Sequence
CATAAATTTAATATTTAAAAGAATATCTTTTACACAAAAATGAATAATTCGGAAGTTGCTGTTTTAGGAGGTGGTTGTTTTTGGTGTATTTATGCTGTCTTCAAGAGAGTCAAAGGAGTTCAAAAAGTTATTTCTGGTTTTTCTGGAGGTGAGTTGAAGAATCCTACTTACAAAGAGGTTTACACAGGAACAACAGGACATGCTGAAGTAGTTTAGGTTACTTTTGATCCAGAAGTTATTTCTTACGAAAATCTCCTCAGAATCTATTTCAATGTTCATGATCCAACTCTATTAAATAGATAAAATGATGAGGATGTAGGAACTCATTACAGGTCAGTAATTTTTTATTTGAGTGAATAATAACAAAAGACAGCTTTAGCTCTCATTAAAGAGCTTGAAGAATCTAAGTATTACAAAGATCCTATTGTAACTAAAGTTGATAAATTTGAAGAGTTTTACCCAGCTGAAGATTACCATCAAAATTACTTTGATATTAACCCTGAACAAAGATACTGCAAAGCCGTAGTAGAACCTAAATTAAAGAAATTTTTGATTAAATATAAAGACTACTTAAAGCAAGAAGAAGAAGAATTAAAGTAAAAATAATTATAGTAAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-18,016.6 L-26,091.0 L-31,425.3 S-0318.7 S-3153.6
S-671.0 S-943.0 S-1234.8 S-1536.0 S-2436.2
C-0106.0 C-2144.1 C-4108.4 C-635.0 C-858.1
C-1076.7 C-1253.3 C-1452.4 C-1647.5 C-1848.3