Summary
Transcript IDgene_000013051
Gene IDTTHERM_01377900
Length316 bp
Sequence
TATGATGATGAATTTTAAAATTTTGTTTATCACAAATAGCTTAAATATATTATTGAAGGATTAACTAATTTTGTTCCAAAGAATAGAATGCCTATTAAGGAGGCTTTAATTATTTTAAAGGGAATTATTTCTTTTGAATTTTAGTTAGATGAGATGCTTATTGAGATGATTGATGGAAACACCCAGCAGTTCACAAATTCACTCACAAATTAAATTGAGTTTGTTAGAGATTTTCCAAATAAGTTTTACCCAATCATTAAAAACGAACAGACCTTAAACTAAAAGTTAAATGAAGACCATCAAAAAATATAATATG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1918.2 L-2725.2 L-31,846.0 S-0884.2 S-31,296.6
S-61,831.3 S-9978.7 S-122,009.7 S-151,334.0 S-241,611.1
C-01,850.8 C-2691.7 C-4807.3 C-6537.4 C-8777.1
C-10617.9 C-12405.0 C-141,003.3 C-161,708.2 C-181,194.8