Summary
Transcript IDgene_000013216
Gene IDTTHERM_00773780
Length351 bp
Sequence
CATAGAATTTAAACTCTTAAAAAATTAACTAGCTTTCATAAATTCAAGGCCCTGCTACAGAGAGATCTACAGGAGGGTATATCTTAACAGATACAGAAAGAAGAAAATATAAAAAAATTAGTATCCTCCCAAATGAATTTACTTAGTACTCTACCGCAAGATCTGTATCTAATAAAGCAGGAAGTAGTTAGGTAAAAAAAAATAGTTTTTTAGAAGACCTCGATAACGCACATCTAATTGTAAACAACAATGTTAATCCATTCCTAATCTCCGAAGCAGGAGACTAATCTAGCCTCATGAGCAAACTCCTACCACATAAGCAAACAGCAGATGCTAATATACCATAAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1808.5 L-2707.4 L-3768.8 S-0909.7 S-3646.1
S-6404.7 S-9757.3 S-12798.8 S-15864.9 S-24712.4
C-0650.1 C-22,047.3 C-42,216.8 C-6873.7 C-81,473.9
C-102,275.1 C-122,742.2 C-141,618.7 C-161,085.1 C-181,193.0