Summary
Transcript IDgene_000013217
Gene IDTTHERM_00773780
Length288 bp
Sequence
CTGAGATGCTAAAAAGATGCATGTTAAAGATATAATAAAAGCTAGAAAAAGAAAAATAAAAAAGAAGAGAGCTGAAAATGTTGGTAAAACAATCTAATATGAGTATTGGAAACTTAAGATAAGATATAAACAATTATTAACTTGATATTCAGCTTGTAAAATAGCTAACTTTAAACACGACAAGAGCTATTGAAAGCAGAGTAAGTCAATCTAATCTTCGTCCTTCTACTACCACTGCTGCATAGTTAACAACAGCTAAAAAAAACCCAAACAATTCAATGTCTAAGT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,185.2 L-2906.1 L-31,047.9 S-01,141.5 S-3792.3
S-6548.6 S-9812.6 S-12827.9 S-15703.5 S-24973.9
C-0657.1 C-22,278.3 C-42,595.4 C-61,015.3 C-81,984.9
C-103,226.1 C-123,557.1 C-141,908.7 C-161,279.3 C-181,612.4