Summary
Transcript IDgene_000013242
Gene IDTTHERM_00947500
Length914 bp
Sequence
CAAAAATAAAAGCTACTTCTAAGTACCTGGTGAAGCAGATAGGAAAAATGCAATTGGATCATTAGCAGGAGTTCCTATTAAAATAAAAAAAGCAATTTAGGCAATTTAAAATGAATTTCAAAAAATAGACGCACCTTAATAGGGAGATTGGCTTTGGGACCATGAAGAACTTGGATAGCCTTATGAATAATATGTATCGACTTTTGAAAAGAGAATTTTTAATAAGGAAAACTCCAATACAATTTATATCCAACCGCTTGAATAAAATATGGGATTTAACAAAGATTTAAAAAAATTTTGTAAGGCTTTTTTTAAAGACTGCAGAGTGAAAGTTAGATAGCCAATAATCATACAGGATATCCCGGCTGTATAGAGAAGAATAAATGAATATACATAAAAGCTGTAACTAAACACAAAGGATATTTTAAATTACTTAAAGACAAGACTACCAAAAGATGCAGTCTGTATGATTGGTATAACAAATACAGATCTATACCCAAAAGATGAATGGAATTTTGTATTTGGTCAGGCTTCGCTTATTCATGGAGTAGGCGTATTTTCATTTGCTAGGTATTTATATAAAAGCAATGATATTCTATCAAACACTTTAGAAGATTAAGATACAATCATTTATAGGGCTTGTAAAATTATGGTTCATGAGATATCACACATGTTTGGATTAAGACATTGTATATATTTTAAGTGTGTAATGAACGGGTGCAATCACTAAGAGGAAAGTTATAAATCTCCTTTAGAGTTATGTGTAATTTGCTTAAGAAAACTTCAAAATAATATTGGTTTCTCAATCATAGAGAGATATGAAGATTTAATTGAGTTTTCTTAAGACAGACCATATTTTTCAGAAATCGATGTGCCTATCTATGAGAAATTGAAAAATTTAATAAAGACTGCCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1399.7 L-2551.5 L-3694.4 S-01,203.4 S-31,408.8
S-62,531.7 S-92,578.7 S-123,439.9 S-154,733.8 S-243,461.2
C-0255.5 C-2185.8 C-4315.8 C-6332.8 C-8240.3
C-10622.8 C-12560.8 C-14413.4 C-16636.3 C-18879.0