Summary
Transcript IDgene_000013519
Gene IDTTHERM_00599960
Length2600 bp
Sequence
TTAAAAATTAATATATCTAATAGTAAAAAAAAGATATTATTAAAAATTTAGAAAATGAGTAAGAGGCCAGGAGAAGAAATTTAAGGGAATGATCCTTAAAAAAAAATAAAAACTGCAGATCTTCCTACAGCTCCAAGTACAGCAAATAAAATATCTTATGGCAGTCTTAAACCTCCAACATCTAGCAGTTCTTCTATATCTTATGCTGCTTTTAAAAAATAATAATTATCTACTATGAAATAGCCTGCTAAACCAATTAGCCAATAATAGGTTCCTTAATCTACAGGATCTAGTTTGACATCTGCTGCAGCAGCTGTATAAAATAATTAAAATGCTTCAAAATAATTAACATAATAGGGTAGTTCATAAGCTTAAGATAGTAAAATAATTGATGCCGCATCTTCAAATTAAAAAAATCAAGATTCTAATGCATCAAATAAAAATGAAAATAAAAACACTTCTGAACAATCTTAAAATAAATTTAGTGAAGCTTAACCTAACCCATAATAAGTAGCACCTAAAACAATTGATTTAAAAAGCTAGTAATAATAAATCATAGAAAGAGCTAAGAAGTTAAGAGAAGAAGAAAAAAGACTTGCTGAATTAAAAAAGAATACAGCTGTCATTTAAAAAGTCTAAAATGCTTAATAAGGAATAAAACCTGGCTAACCAAGTTCTATAAGTCAAACAAAAATTCAAAAAGAATTAAAGAAGAAAGAGGAAAAGAAACCTCTTACAAAATAAGAATTAGAAATGAAATAACTTTAGGAATTTGCTAAGAAAAAGGAAAAAGAATAAAAATTAATTGAAAAATTGCTGAAAGAAGGCAAAATAAAGCCAGAAGATTTAGATAAATCAAGCAAGAAGGAAGAGATAAAAATTGACAGCAAAGAAAAAGAAGTACGTTTAGATGAAAAAGGTAATTTAATCGATATTAAGGGTAACATAATTGTAATTGACTCAAATAAAAGCACCTTAAAAATCAATTAACAAAAGAAGCAACTAGATAAATTAACTAAAATGGCTAGAAATGCTCGTTTTTAAAACTCACAAGTATTTTAAGATTCTAGCATATTTACTACAACAAGTTTAAAGAGAGAAAGGAAGAAAATGCATGCACTTAACTTTATAGAAGATACAAATTAAATTGAAGACGAAAAAGAAGAATATGAAGATAAAATGGATATTGAGAGTAAGAGTGAAGAAGATTAATCTGGTTCTAGTTCAAGTGAAAGTGAGACTGAACAAAAAATGGAATAAGAAAACCAATAAAATGAAGAAAATATAGAAAAAAATGAAGATTTCAGATAATTGATTCAAAAAACTGAAACTGATTACAGAAGAGAAGATTTTTAGAAAACAAATAGCAAATATTTACAAAGTTTACACAAAAAAAAGTAGAGTTTGAAGCAAAAGCATCACGATCCTATTCCAGATATTGAATGGTGGGATTTGGCATTATTCGATAATACTAGAAGATACTACTTACCATTAGACCAAGCTAACTAAACAATTGCTAATTAAGCAATTCAAGCAGGAAACGAATCTAATGCTACAACTAATAACAATCCTGAAAATTAAACAGCCAACGAAAATAATTTGTCAATTAACATTTTGGATAATTTAGAGATTATTAAGCAATTATTGTCTAAATTATAAGTTGAAAATTTCGAATACTCTAAGGATTATTATCGTTAAGAAAAAATTACTAACTTGATAGAGCATCCTAAGCCTTTTAAAAATGATGGATTGCCTAATTCTAATCAACTCGTAGTCATTCCTAACTACTTAACTAAGAAAGAGTAAAAAAAGCTGAGCAGACGTCATCGTTTAGAAAAAGAAAAAGAAAAGCAAGATAAAATAAAATTAGGATTAATCAAGCCTCCTCCTCCTAAAGTTAGACTAAAAAATATGATGCGTGTTTTAGGTAATGAAGCAGTTGCTGATCCTACAAAAATGGAAGCTTTGGTTAGATAAGGCATAGCTGAGCGTTTGTAGGAGCATCTTCGTAGAAATTAAGAACGTTAATTGACTAAAGAGCAAAAAGCTGAGAAATTCTTACGTAAGCTTAAAAGAGATAGTGCTATTGAATGTAGAGTAGCCCTATTCAGAATTGAAAATCTATAAGACAGAGTTCATAAGTTTAAGGTTGACATCAATGCATAATAAATGTAATTGCATGGTGCTCTTATTAACCCAGTAGAAAATCCTGAAAGTAGATCTACTATAAATATGCCTGCAATAGTCCTCGTTGAAGGTGGTCCCAAGGCAATTAAGTTTTATAAAAAGCTTATGCTTCGTCGTATTAAATGGAACAAAAACAGCTACTTACCTAAAGATGAAAATGGTGAAATTATTACTCCAGTTGACTTGACAGATAATAAATGTGCTTTAGTTTGGGAAGGAGTAGTTAAAGATCACAATTTCAATAAATGGAAAGTTCATGATGTGGACAGTGAAGTAGAAGCTAGAAGAGTTTTTACAGAAAAAAATGTAGAGTTTTACTTTGACATGGCAATTAACTATTAATATCCTAATTGAAAAGAAAATTTAAATTGAATTAGCCTTTTATTTTTCTATTTATGAAAATCTATTTGAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,095.4 L-23,894.3 L-33,301.2 S-01,779.9 S-31,691.8
S-61,458.0 S-91,426.7 S-121,837.7 S-152,169.5 S-243,015.8
C-03,571.6 C-24,110.9 C-41,980.6 C-65,334.5 C-84,871.6
C-105,111.8 C-122,777.6 C-142,376.6 C-162,709.3 C-182,213.3