Summary
Transcript IDgene_000013531
Gene IDTTHERM_00600400
Length688 bp
Sequence
CATAAAGTAATGCCCATTGCTTTATTCGTTACTTCATTTGATTTTATTACTCATCAAATTTCAGTCTAAGATATGAATGTAGCTGGAAGAAATATGCTAAAGACGTTTGGCCCAAAAATAAATGAGTTAAAAGAAATTTTTCAGCAATTTAAAATAAAGTAGTAAATATCCTCTTTTGCTAACTCAAATTATTCGAGAAAAGACAATAGCTTTAAAGGAAGACCAAGAACTGTATCATGTGACTTATTTTAGTTTCTTTTGTAGAAGTTTGTTTACATCCACAAGTATAACAACTTCTTCTAAAAAAAAACTTACATCTTTAAAGAGGATTAAGAAGATATTTTAAACGATTGCAATTAAGAGGAATAAAAGTAATTCGAAAAAGATTTTGTTAAATAAGATACCCAAAAGATGACACAATTAGATTAGTAAAATATTTTCAGAGATGATTTAACTAAATCAGAATAATTGAATTGCTATGTGATCTAAGATTAAAGTAACGAGACTAGATATTACTCTGTAAAGATAATTCCAACCTTCATAGAATAACCTTCTATCTTATTATTAATTGAAGACCTTAAAATGAGGAAATAAAATAAATATTTTGAAAAGCAGTAAACAAAGCAATCATAAATTCATAATTTTTTTTTCAGCGATATTCAATAAAAAATTTAGAAACAAATGTCAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1261.2 L-2204.4 L-3125.9 S-0107.2 S-3139.3
S-6131.3 S-9100.1 S-1258.2 S-1573.1 S-24226.3
C-0245.4 C-284.7 C-474.8 C-630.5 C-874.6
C-10136.0 C-12127.8 C-14168.5 C-16156.0 C-18181.9