Summary
Transcript IDgene_000013740
Gene IDTTHERM_00334410
Length453 bp
Sequence
GTGAATAATAAGAACCTTTAATACTCCATTTATCTGGTAGAGGTATTTGCCCGATGGTGAAATTCTCAAAAACTTTATTATAATTTGGAGAATGTTTAGTTAACGATTACAGAGATATTATTCTAGTCCTTGAAAATAGAAACAAAGATTTACCAATAGATATTAATATTTAAAATACACCTGGATTTCAGTTTGAACCAAAAAAGTTTACAATTTAAGAAGGAGGATAAGTTCCGATAACTGTAAGATTTTAGCCAAAGAGTGTTGGAAAGTTTAACCAAAATATGATCATTAAACTTGTTGAAAATGCCTATGATGTCAAAGTTAAACTTTATGGAGATTCGACCGAAATAGGTCTAAGGCATAACTAATAAAGAGGACCAGAAAGTTTGCCTGAAGATTTCTTTATGGAAAGCAAAATTATAGATGAAGAATCAATACAATTTAACTCAA