Summary
Transcript IDgene_000013741
Gene IDTTHERM_00334410
Length461 bp
Sequence
TAAATACCTTGAATCTATTCTTGATACAACTTAAATAGCTAAAATAGAAGAATTCAAAAAGAGTTTTGATAATAGACAAAAGTATAACAATGAGTTAAAAGAGCAAAGACAGCAAAGATTGAAAAAAGAAAAAGACTAAAAAGTTTAAGAAAAGTTTTAATAAATTAAAGAAAAACTTAGATTATTGGGATATGACGATGGTGATAGTAAGGAAAACGATGAAGATGATGAAAACAAAAAACCAATAGGCAATAATCCATTTAAAGATGCACCTATTGATTATGAGTATGAAGTTGGTATGGTAGACTCTAAAGTAGAACCTCCTTCATTAAGTTTACCTGAAGCAAAAGAATCATTGTTTGTTACTAAACCTATTGATGACTATGAACCATTTAAGTAAGATGACATCAAAAATTTTGAACCAGACCCTAATATACCTGTTAAAAAGAAATTTTCTAGTG