Summary
Transcript IDgene_000013772
Gene IDTTHERM_00338550
Length870 bp
Sequence
TGTAATTATAAATTTTTAGATATGTAGGAAGCATAACAAGACTTGCCTTAATGGTTAAAGGCATTAAAAAGATCAATTATCAATAATAGATAGCTTTAGTTTTCTAATATGTCTCAAATCGCTTATGTATTTAATGGAGAAGCCGGCATAGATAATATTACTTTTGATTCTTATGAGAAAGTAATTAGTGATAATCCATTACAAGAATATTCCCTCATTTACACAATTGATTCTAGAAAAAATACTTTTAATGAAATGAAAAACAATAAAGTTGTTGAACTTTGTTGGTATTTCCCATTGACTAAAGAATAATATAAAATAAAATGCCATTTCTCTTTTATTGCTTTATAATAAACATAAATAAATGATATATAAATAACAGAAGAAATCTTAATTGAATAATTACCCTAAAATTAAAGAGAATTATTAGAAAATGCATGGAATAAAGTTGATAAAGAGGCAAAAAAATTGTATCAATCACCTCATCCAGATACCTGCAAACCTAACTAAGAACCTTTAGATGATTTAGAGCGTTTTAATACTCCCGAAAAAAATAAAATATCTAATAATTTTGCTCTATTAGTGCTTACTCCTTTCAGAATGGAACATACTTCATTTGCTATGCCTTAAGTTGTTGCTGATGGTCGTAAAGAATTCGAATCTATATTTAAACCCTACAAAAAACACTCAAAATATTTATATGTAATTGAGAATAATCAATGGAAAGTTCATACTCTTAATCCTTGATAGAATATTTTTTTTAATGCCAAAAAAGGAAAAATATTAAATAAATTGCACTGTCTTTAATATATAAATTATCCTTCCAAAATATAATTATATAATTAGAATAAATATTATTTTTTTTATAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,368.9 L-21,262.0 L-31,004.5 S-0217.4 S-3367.7
S-6523.5 S-9540.4 S-12571.5 S-15571.3 S-24535.6
C-0520.6 C-2387.1 C-4709.2 C-61,155.1 C-8981.0
C-10672.9 C-12382.2 C-14359.2 C-16421.8 C-18402.1