Summary
Transcript IDgene_000014046
Gene IDTTHERM_00370920
Length899 bp
Sequence
AATATAAATAAATAAGTAGGAATAAAAAATATATAGATGGAAGAAGAATATTCAGAAAAGATAATTGGGATAGTGAAATCATACCAAGAGGGTATAACTTTAACTGAACTATTAAAGATATTAGAAGTTGATTAAAATGCCATTAAGCCAGAATTATAGAATTTATTAAAAGAAGGCTATTTAACTTGCACTAATGTAGGTAATGAATAAATAGTAGAGTACCATGATCCTCAAGATTAGAAATAACTAAATGTGGCAGCAAGCGATCTACCTCAGCAAGAATTTTAAGTTTATAAGATTATTTTCCAAGCTAAAAATAAAGGTATCGATAGAAAGGATATAGGCAATAAAACTGGTATTGCAACGGGAACTTTAACTAAAATATTGAATTAACTTAAGAAAAAAAATTGGATTAAATCAGTTAAAGGTGCAAATAGTACAGGAAAGGGTAAAAATATATTTATTTTAAACAATCTAGAACTGTCTGAAAGTATTTCAGGTGGTATTTGGTATAAAGATGGTGTCCTTAACAAAGATTTAATTGATGAGTTATGCTCAAAAATAGAAAACCATATGAATCATAATCCTATAATGACTGAAGAATAAATTATTTAGTTATTAAGAGTTAATAGCTCAATCAATTTAGAATAAAGACATGTACTATAAATTATTAATTTATTACTTTTCGATGATAAAATTGAAAAAGTAAAAACAATTACAACATCAACCAATTCAAGTACAGCTTAAAAATAAGGAACCTCATAAATATAGAAGTATAGATTATCAAATTGGAATAAATCTAAAGACCACATTTCTACTATCCCAGCTTTGACAAAAACTCCGTGCGGACATTGTCCTTTAATTAACGAATGTGTTCCTGGAGGGAAAATTTCACCAGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,654.0 L-21,595.3 L-31,168.4 S-0487.8 S-3432.5
S-6369.5 S-9268.1 S-12236.4 S-15230.6 S-24185.9
C-0251.9 C-2471.4 C-41,529.4 C-6603.1 C-8395.7
C-10723.9 C-12406.3 C-14409.3 C-16284.2 C-18281.5