Summary
Transcript IDgene_000014050
Gene IDTTHERM_00370840
Length2116 bp
Sequence
AAATTAAAAAAAGAAATTAAAGATAAATTAAAAATTTAAGATAAAATGATATATTCCAATTGCCCATTACACTCTAATTATGAGCTTTAATTCATTAAAATAAGGAATCTAAGTGAAATTGATGAACATAGTATATTTTATTGCGCTACTTGTTTAGACTAATTCAAAAATTAAGAAAGTAAAAACTTTTTATCAATATAGAGAATTATTTAAAGTAGCTAAGATTAAATATTACAAAAATGGCCTCCTTTAAATGATAATAGCATTTTAGAAGATTTAGGTTCTATCTTAAATGGTTTAGGAAATGAAAAAGATTTGATTGAAGATTTGAATTAATTTTTTAATTCATTTCTCATTTCAGTTCAAGAAAAAATTAATTCTAAAAAAGTTTTTTTCATAAGCAAATTAGAATAGGCATTCAAAGATAAAAAAGAAATGACATAAAGATATTTTAAAATCTCAAAAGTTGATGCTCTAAAAAATATCTTATAGAATTAACAAGTAGATTTAATTACAAAAGAAAAATAATTAAAAGAACTGCTTTCTGTTGTTAACAATGAAATTAATTTAAATACTTAAATTCTAAACTAATTTGTTGAAAGCATGAATGTTATTAAATAAATCAACAATTTAAATCTACAAAATGCTCAAAATCAAATTCTTAATTCTTTAGATTGCTTTGGCAATATAATTGATGAAAATGAATAATTAGAGTCTACAATTATGGCAGATAATAAATATAACTCATAAATAATTAAGCCATCTATTTCCTATGATTCATCTCTAGAAGAGCTTGATAAAATCTTAGATTTTTCTATTATTAATTCTAACAGTGATAGCAAAAATTTTTTATAAAAAAGCATTTATATATAAAACAAAATAAATGATTTAATTTAAACTTCTTAAATTAACTTTGTAGTTGACTCAACGTATAAAAACGAAAATGAAATAAGAGCCCAATAAATTGAATAATTTGCAGAGTTAAAATTCTAAGATGAAGAAAAAGTTGTTCAAAATCCATAGCCTAATGAAGAGTAAAAAAGCATGTGCTTTACTTATGATTCTTGCATTTCAAGTCTTAATAAAATACTCAATTATTTAGTTTAAAATAATTTAATAGAAGACAAAAAGTTTTAGTTTAATAATCTCCAATAAAATGATCTTTTGAAAGTAATTGACTTTGCTACTCATTTATAGAATTAATAAAATGAAGAATCATATTTAAAAAATGTATAAAAAACAAATCATGTGAGAGTATTAAATGATATTATATCGGAAAAACTATCAAGTATTTTTAGTCAGAATTAAATAGAAAATTATTTGATTGAAACATTTCCTTCTCTTGTAAGTAACTTAGATTCGGAATTGCTAAATACTTATAAATAGAACACTTCTTAATTGAAATACAATCTCATGCCTTTAATAGTATTCAAATAAGCTACAATGAATAGAAAATTAAATCCTTTGAATATCAAAAAATTGTCCAATGGTGTAATTCAAATTAAAGCAACACAAAATAAATATTACACTTAGTGTTTTTCAGATGTATTGTCTGCTAATGCTAAACTTGTTTTCAGATTTAAAATTGAATGCACATCTGGCTTAAAAAATCTTAGTTTGGGTCTTGTCTATGATAAAATGGTTTGCAATAATGCTCTAATCTGTGAATTAGATTGCTAACTATCATATAATAACAATGAATTGTTTGTTATTGGAGGAGCTATTTCTAATTCTCGTAAAAAATAAAATACATTAATGAACTGCAAAAGCTCTTTGCTTGAAGTTAGAGTTCACTTGAATAGCAAGCTACTAGAAGTTACCGACTTTCCTAACTACAAAAATAAATTTTCATTACATGAATAATTTATAAATAAGATAAATGATAAATAATTGAGATTATTTATTTATCTGAATAGCCCTTCCTTTACTATTTAATTACAGGAATTTTTTGCTGTTAATGAATACTGAAAATGAATTCTTGTGTATGAAAAATTTATTTTGCAAATACATTTTATCATGTTGCCAAATTTAATTAATGCTTATTAATTTTTTATAATTCAGTAAATTATTGATTTCAGTGATATTAAGATTTGAAAACTTTATTTATTATTTAGCG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-126.2 L-226.5 L-322.3 S-029.4 S-327.4
S-624.3 S-930.1 S-1236.5 S-1530.7 S-2428.1
C-027.3 C-28,089.6 C-412,951.1 C-613,200.5 C-87,586.7
C-102,162.0 C-121,298.8 C-142,878.3 C-161,983.4 C-18862.9