Summary
Transcript IDgene_000014087
Gene IDTTHERM_00283340
Length1054 bp
Sequence
TTTTAAATCAAGCAAGTTTTTTAGTTGAAATCAATAATAAAGAGCAAAATTAACCAAAAAAAAAATGTAAAAATTGAGCCCACTAGATCAGTTGGATCCTAACAATGTTGGTGGAAGAGAATAAATGATAAACAGGATGTATAGTCATCAAACAGCACTTTTAAAAATTAAGCCAACATTAGATACAAAAAAGCCACCAAAACCGCATGTTGATGCAAATAAAAAGGATAAACCTCCTTTGAAATATAAAAAATTATTAGAATATGGAAATGTTTATAAAACATTCAGTGCAGTTGTGGGAGCTTCAAAACCGTTAATTGACTCAAAAGAACCAGAAACAACTAAATTCAAATCATTTTGGGGAAAGAAAAATAAAGCATAAAAATTTTAAGAAAAAGAACATGAGCTTAACCTAAGAGCATAATAAAAAAGAATATAAGGAATAGGTTCTATGTAAGAACGCAAAAAGAATCCTAACGACCCACTTGCTCATCCTACATACCTATTAAGCTCTGATCCCTAGCCAAAAACTAATAATTATTTATTAAAGTAAATACTTAAGCCTTAAAAGACAGCAAATTAAATCGATCTCAGCAGACTTTACCCGAAAAAGGAAAAAAAAGAAAAGCTATAACCTGAAGGAGGTTAGGATTAGGTTTATTAAGAATTTAGCTTTCGTCCTCAATCAGCAAAGCCTGTTGAAAGATCCAGTAGCTATATGAAAAAAACTGATGGAAAAAAAGAGCCCCCCAAACCTGTAATTGATAAGAGCAAGAGACCTCAAACGGCTAAGACTATTACTAAAGAATAATACGAATAATATAAAAAAGAAATATAAATGAAACAAAGTGGTATTATCGAAGTAGATTTTGTAGATGAGATCCCTAAAGCCAAGGGAGTAAAAGAAAGTGATTATGAATATATAAAACAAGCCCTCATATAGTTATTAATTAAATACAGAATATACTAAGAGAGAGACATGAAAATTCTGTTTGGTCGTACAGTTGTTCATAATTAACACATGAAAATGGATAAATTAGATTAAATATTTGAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,022.4 L-21,021.4 L-31,276.9 S-01,828.7 S-31,444.4
S-61,348.7 S-91,241.0 S-121,084.9 S-15944.8 S-24935.5
C-01,249.2 C-24,849.0 C-41,799.7 C-61,294.3 C-81,103.3
C-102,569.7 C-123,267.8 C-143,293.4 C-162,403.4 C-182,131.8