Summary
Transcript IDgene_000014104
Gene IDTTHERM_00284180
Length1547 bp
Sequence
CTTAAATTAGACAAAATGATTAAAAAATTCGTCTTAGCATTCTTAGCATTTACATAGGCTATCTTAGCTGCTTAAGATCCTTAAGGCAAGCTTCTCTAGGTAGTAGAAACTTTTAGACACGGAGCCAGATACCGTATTTATAATTCTTCTTATCCTAATAACAATTAAATTAATTATGGAGAATTAACTGCTGAAGGATAAAGAATGCACTATGTATTAGGTGTAACCCTTCAATAAAATTATGCTCAAAGTCTTAACTTCCCTGATAAATATGATCACACCTTTATTTATGCCAAGTCTACTAACGTAAATAGAACAATAATGTCTGCTTACAGCTAACTTGCTGGTATGTTCCCCTTAAATAAAGGCATTGATGTTGAAAATATCAACACCTAATTCATGGTTCCTCCTTTTACTAAAATTGCTGATATTGGCTAGTAAAAGTATGCTTTAGCTGGTGGATAACAACCCATCCCAATTCATGTTAAAGAACAAAAAGATGAGAAACAGTTACTTGGTTACGGCGATGCTTGTAATAATTCTCCTAAATGGAGCCAAAAAAATAAAGACGATTCAGACTGGAATAGAATAAAGGGTGAATTCTAACCTTTGATTGACAAATTGGCTAACAACAAATTCTTCCAATTACCTGCTAATCCTGATTTGGATACCATAGCTCAACTTGTTGATACTCTTATTGCAATTAAATGGGCTGGAGATGATGCATAAAATACATTAATTGCCGCATAAATAGAAGGTTTCTTATTACCTCTTGATGAAATGATGAATCCCAATAATTTTAATGTTATGTGGGTCTAAATGAACTTACTCTACTCTATCTAACTTCACTTAGCCCTTTTCAAGACTGAGCAATAAAAGAAAACTTCAGTTACTCCTTTCTTCAATGAATTGTTAGCTTATTTCAATAATTATTTGAGTGCTAAGGATACTTAAAATCCTTTTTTCAAGTGGATCATGCTTTCTGCTCACGATACTACTATAGCCATGGTTGCTCAAGGACTTAACTTAACTAGCTGGTAATGCATGGAATAAGTTAAAAATCAAACTTTTGCTTCAAATCCTAGCTCTCCTTGCATTTACACATATCCAGGTTTTGCATCTAACATCATTTTTGAACTCTATGAGGATAATAACAAGAAACCATACGTCAAAGCTCTCTACAATGGAACTGCATAACCCTTGTGTGGCACTGCTGACACATTCTGTTATCTTGACTAATTCACATAATCAATTTCTTACTCTATTGTATCTGATTTTGATAAAGAATGTGACAACCCTATTTATGTTTCTAGTCCTGACAGTTCTTCAACTCCTACATGGGCTATCGTAGTTATAGTAATAGTTAGCGTTTTGTTTGTTGGTGCTCTAGGTTATATTTTCTTCCAAAGAAAAAAGATTTTATCTTTACAATCTATCGATAAAAATAGCAATTACTCTTAAATTTGAAAATAATTATTTGGCTTTAATAAAATTTAATAGTAAAAATAACTATGTGTCATTATATATTCTCAAGTATTCTAAATAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-19,055.5 L-29,370.4 L-39,458.6 S-02,531.3 S-35,811.6
S-65,429.9 S-96,593.0 S-125,273.7 S-154,770.5 S-244,061.8
C-011,075.7 C-27,981.3 C-43,320.3 C-62,334.2 C-83,466.5
C-105,101.1 C-123,863.1 C-145,655.2 C-164,492.6 C-184,749.0