Summary
Transcript IDgene_000014194
Gene IDTTHERM_00310520TTHERM_00310530
Length287 bp
Sequence
AATAGAGCAGGTAGAAACACACTTTAGTCATTCATTTTGTAGATTAAATGATGGCCAGATTCTTCACTGGGGATATGTTTTAGATAGTTTGACATCAACTAGAATATTGAATTATTATAAATCATCGCCTAAACTCTGCTAAACTTGGTAAAAATACGCTCCGTTCGGGAGGACTTTAAGTATGAGACTTGGAGAAGAGTAACTTAATTTAATGAACGTAAAAACAGTCATGTAAAAATAAGCAGTAAAATTTTCAATAGGAGGCGGATTCATTTTAGCTCTAAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,053.1 L-22,568.7 L-31,881.6 S-0292.6 S-341.0
S-673.2 S-9113.0 S-1289.9 S-1571.3 S-2475.8
C-052.3 C-250.3 C-444.3 C-632.4 C-8122.9
C-1054.6 C-1257.5 C-1438.1 C-1649.3 C-1880.9