Summary
Transcript IDgene_000014309
Gene IDTTHERM_00138050
Length942 bp
Sequence
GAAAAAAGGAGCAAAAAAGTATCTTTTTTTCATTTTTAAATAGAAAGAATTTACAAATATTTATTAACAGTGTTCAAATGTTTGAAATTATTAGCAAAAATGCTAAATTAATAGGAGCTCTAGGCCTTATTGCATTAGGAGGCATAGTAAATTATGTTTTGTTTAAGGAAGATTCAGAGGAATAATAAAATTAAAATAAAATAAATGAAGAAAAATAAAATGAATAGCAAATGTAACAAAACTTAGGAATGACAAAAGATGAAGCAAAGGAAAAAATGCAAGAACTTTTATAAAAGGTTAAGAAATAGTCTGAAGAATAATTTAAGGAAGTAATCAAAAAAGATATAAAGGTAGAATATTATGGTTAATTCATTAGTGATAAAACTATTAAAATAATTATGCATAGAAGCGTTTTGTTTTGCATTGATTCACTTATGAAAATTCACTCCAAATTTATTGAGTAAAGATAAGAAAAGTATTATCAAATAGCTGAATATGCTGCTATTAATAACGAGTTGATTCAAAATTACTTCTATATTTTAAATATTTCTATGGAAAACATTACCCAAATCTTAGAAATTTCTCAAGAACTTTTCTAAAGTAGCTTGCGTTACTGGTAGACTTAGCAAAAAATCTCAAAGGGATATTTAAGAGATTTAGCATACCATTTTATGGCAGAAGCAAATATAAAAAACTCTATATCTAAAGACTAGTACATCGATTACTTGCAATTTGTGTGTGAGGAAATACCAAAGCAAGCAAACTAACTTAAGCTTTTACTTTCATAGTCAACTCCACAGCTTTAAAAGATAGTGATTCTTTCTAGAGCAGAAGATAAAGCCTTTTTTGATAAAAATATAAGTGATTTATAGGGTATAAAAGCCTTATCATTATATTCCTAAGATGAAGAGTGCAAATAATTGCTAAATAAAAGAAATGAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1348.2 L-2304.1 L-3211.0 S-0232.4 S-3291.5
S-6294.1 S-9444.5 S-12646.8 S-15946.6 S-24689.2
C-0247.9 C-290.0 C-4225.2 C-6236.8 C-8130.4
C-10116.3 C-12159.5 C-14144.8 C-16170.3 C-18161.5