Summary
Transcript IDgene_000014530
Gene IDTTHERM_00151250
Length657 bp
Sequence
AGAAATCTTTGCATAGAAATAAAAGAAAAGATTAAGAAATTAAAAATAAAAAGGAAATAAATAATAGATAAGGGAAATGAATAGATTCTTCAAAGTTTCATCAAAATATCAATACTACAAGTACTTGGAATAGTATGATGCTGCCTTCTTGAGAAAATATCAATCTGAAACCCACTGGTATTTGGGTAGAAGAGGTGCCTGGAAGAATTTAGTTATTAAGTATGCTGGTGATCATATCTCTTTGGAAGAAGAACACAACGTTAAATATAAGACTCACTTATCTTTCGTTTACTTGAGTTACAGATTGGCTTGGGTTCTCTTTGCTTACGTTCTTATTTACAATCACTTCCTTTTGGGTGATATCGGTAAAACTTTTAATGTTGGTGAATGGGATCACAGACTTAAGCCATCTGCTGAAAGAGATTATCCTACTCGTTATGAATCTCTTTACATTCTTGACAGAACCCAAAAGTGGTGATATATCTTAAATTTATTATCAGAAAATATTAAGATAAAAAATAATTTAGGGTTTATCAAAATATTTTAATAATAAATAAAACTGTTCTTAGCGTTTGTTTGCATATCAATTAAGCAATCTCTATGTAGCAATCACTTTAAAGATATCAATCATAATTTAATCTTAGCAGCAAATTTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-122,644.7 L-220,800.8 L-321,766.8 S-015,897.0 S-311,355.9
S-67,396.0 S-96,712.5 S-126,022.5 S-156,311.5 S-244,624.7
C-03,744.3 C-24,489.7 C-43,154.7 C-65,836.2 C-85,207.0
C-105,745.1 C-125,203.1 C-145,113.2 C-165,253.9 C-184,422.1