Summary
Transcript IDgene_000014537
Gene IDTTHERM_00151470
Length1345 bp
Sequence
ATTATAATATACATAGTAATAAAATAAAAAAGTATACATGATCTCCAGAAGACTCCTCCACTGTTTCAACAGATCTTCAAAGTTATTAAACAATAAAAACTAATATAGATTTGAATCTTTGAATGATACATCCAACTTGACTGAAGACTAAGTTTTGGTTTAACAAGCTGCTTTGAATTTTACTAAAGAGCATCTACTTCCTTTTGCTAGTGAATGGGATCAAAAGAGCTAGAGCCCTATTGAAGTCTATAAAGAGGCTGGTAAGTTAGGATTTGCTTGTATTTATTCTAGCCCTGACCACGGTGGTAGTGGAATGGATAGAGTTTCTGCTTCTCTCGTATTTGAAGCATTAGCTACTGCATGCGTTTCTACAAGTTCTTACTTATCTATTTTAAATATGAACCACTGGATTATTGACACTTATGGTAATGAAAAGTAAAAGGCTGAATGGTTACCTTAACTCAGCACAGTTGAAAAATTCAGTTCTTACTGCTTGACCGAACCTGGTAGTGGTAGTGATGCTGCTAATATGAAAACTTTTGCAAAAAAGGATGGTGGTGATTATGTAATCAACGGTTCTAAATGCTTCATCTCAAATGCTGGATTTAGTGACCTCTATGTCGTTATGTGCAAAACTGGTGAAAACGAAAGATCATGCATATTGGTTCCTTCAGATGCTAAGGGATTATCATTTGGTAAGCCTGAAGTAAAAATGGGATGGCATGCTTCTCCTACTGCAAGCATTACCTTTGATAATGTTCGTGTTCCTTAATCTAATTTAATTTCAACTGAAGGTAACGGCTTTAAAATTGCTATGACTGCTCTTGATGGAGGTCGTGTTAATATTGCTTCTACATCTTTAGGTTCTGCAGCTCAATGCCTTGCAAAGACAAAGGAATATGTTGGCTAACGTAAATAATTTGGCAAATCAATAGACTCATTCTAAAATACATAATTCAGAATTGCTGAAATGGCTACTGATCTTATAGCTTCAAGACTCCTTGTTAGAGAAGCTGCTAAGAAAATTGATTTAAATCACCCTAATAAAACTTTATATGCTTCTATGGCTAAGATCTAAGCAACTGAAAAGTGCTACAACATTGTCGACTAATGCTTACAACTTCATGGTGGTTACGGTTACATTTCTGAATATAACATTGAAAGACATCTTAGAGATTTGAGAGTTAATCGTATTTTAGAAGGTACAAATGAAATTATGAGACTTATTGTTTCACGTTAAGTTATTAAATAGTGATTAAATAAATAAATAAATTAATAGTCGGTCTTTTTCTTATATATTTATATATTTCAGAATTACAGCCAATTTTTAGTTTGCATTTAAGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-127,158.7 L-225,540.4 L-320,735.8 S-02,541.6 S-31,064.1
S-61,581.7 S-92,768.2 S-122,642.7 S-152,818.4 S-242,193.2
C-01,816.3 C-29,821.0 C-45,331.6 C-62,354.5 C-83,590.8
C-105,060.9 C-127,649.0 C-147,223.9 C-164,540.9 C-182,991.3