Summary
Transcript IDgene_000015278
Gene IDTTHERM_00455610
Length2950 bp
Sequence
TCATTAATAAAATAAATAAATAACCAAATTGAATAAATTACATTTAGAATTTTCATAACCTGCTATTTTAAGCCTAGAATTAAATGGAGAATAACCTTTTAGAATCAAGACTAAATAAAATCTTGTCAGATAAAAAGTTTAGCAAATTGAATAAAAGCATAGAGAAGCATCTCAATAAGGAAACAGGCATTTTTATTAAGGACTACTTTTTAGTTCTTGAATATGAATCACTTGATGAAAAGGTAATTCAGAGTAAAAAGAAGGAGCTTTTAGAAAATTCAATGCACGATCATATAGAAAAAGATGACGATTCTGTTTAATACTTTGCACTATACTTATGGATTTTTAATTTGACTGCAGGCCAATTCTTAGAAAATAACGAAAATAAATTAGCTACTAGAATACCTGTAAATTTACAAAGTTACAACATGTTCAATGCACAAGATTAATAAATATAGTCTGCCAAAAACACAATCGAAAGCTTTGGTAACGTCTTTTGCATGTCTAAGAAAATCGGAGAGTAATCTCTCTAAATAATAAATAGTAATATAGATGAATACTAAATAGCAATTTATTCTGAAAAATAAATTTTTGTTGGCCATATTGAAAACATTATAAATTCCTATTTTATTAAGCAAAGCAAAGATGATCAAAATGCCTTTACAATGTACCGTGTATAATTATTTATATAAAAATACTCTCCAAGCATTTTAAGCATTAAATTCCACAAATTATCTCCTCATCATTTGGCTGTTCTTTTAGATGATTAGTACTTTTGCGTTTATAATCTGCAATCTAGTCTTTCTTACTAGGAGGTGTAATTTAATCTTTAATAACTTCCACGCTTTGGTAGAAACGAAGAGTATAATTATTAAGAAAAAGGATAAGTTTAGTTTGTTGATTTCGAATTTGGAGGCAACAGCTTTTTCACTAGCTATTCGAAAACCAATTTCTAAATTCCTTCTGATTTCGATTTTCTGTCAGTATATTTTCTTACTGAAGATGGTTAAATTTACTACCAATCTCCATTTTTAGTAAAAGATATGAGAATTAACAGATAATTAATTGAAGAACTTAAGGATTATCTTGTTCAAGAATTAAAATTGGTGGAACAGCATGAATAAATATAAGAAAAATTATAGGTGTTAAAATCTTATTTAGACTTAGTAGAATAAATTGACAGCAGAGATTTGATAAGTGAATGCGAATAACCTACCAAATTATCTAAAATAGTTACTCAAACAGATAAGTCCAGTTCATTTGAAGTTCCTATTTTTAATAGCATCAGCATGCAAGACTTGCTGAATGATGATTTCTAAATACAATTAAGATATGTTCCTACAGAATAAAATAACGAAGATGATTAAGAAAATTTAGAAAATAACAGTAACTTACAGTCTCAGTTTAAATCAAGTGGCTTTGGAACAAAATCTAACATCTAAGTTTTTTCAAAATCGTTAATGGACAGATTTACTAGAGATAATAAGAATCAAATTATGTATAGGAAATATAGTAAATTCCACAAAGTGGAAACAAAGGGTTAACTCCATGTCTTTATTTTAACAAAGCAAATCGGTAATAAAACTTACTCTACTGTATCTTCACGTTTTAGTCCTCTTCCAGTCATGCCTACTCATATTGTTCAAGACTTTTACTAGTTTTGTCTTTTATCTGGTGAAAAAGCACATCTTGAATGCCCATTAAGCTCTTTAATCAACTATACAGGAAATTAATCTAAAAAGAATATCTATGAATATAAATAAAATTAATGTGCTAGACTCTGTTCTAAGGCAATTGAAACATCAACACTTGACAGTGTTTGCTTCTAACTTATGAATAGAATATATTGTATTAACTTTAAGTGGATTTAGAATTTGATTTTAACAAACTTATCAGACCCTAAAGTATTTAATGATGAAGAATTGTCTAGAAGTGAAATTAGAGTCTTAGTTGATTCTCAGCAAATCGATAGCTAGGATAAATTAGATGCATGTAAATTAACAGATTTATCTTTTTATTGCTTATCTGAAAAAGACAGAATGCTTCTAGCAGTTATTCCTTCCCACCACTCACAATAGTAATAGCCTTTTAGGTTAAAATGCTTAACTTTAGACTTCTTGTCAAACTATATTTAAATTTAAAAGAGTGCTAAGCTTATATCTGAGACTTTACACAAGATGATTAAAGAATAAGTAGAGCCTGAAAAAGCAAAAGAAAATAACCAATCAGGATAAAAACTAGCTTAAAATGATGTGAAGCTTCAGGAAATTGCTGATTAAGATAATAAAGTAGATCTTGATAACTTTTAAAAGTAAGTAACAGCTTACATAAGCAAGCATGAAGAAGTTTTATAATAGAATATTTAGTTAATACAAATTAAATATCAAGAGGTATTAAAGAAAAAAGAAGAGTTGAAAAATACAAAGGAAAAAACAGAAAGCCAATTTTATGAAATCATAGAAAACAAATAAAAGAAGTTGTTAGAAAGCAAAAAAAGAATTGAAGAAAAAAATAAGTCAATCAATTAAAAAATTTAAGAAATTGCTTAAAAATTAAAAGACCCTAAAGCTTCAAATGAATTAGACAATGTTAAAGAAGCAAATATCACATTTAATGAAAAATATAATGAGTAAATTAAGACATACTATAATAAACTTAAAGAAATCGAAGAATAATACTAAAAGTACTTCAAAACTAGAAGTGAGTTCTTCAATTCATTAGGTGTTCAAAGCAATACAAACCTACAAATTGATGAAAACACTTTATAAAAAATTAATGAAACAAGAAATAAGCTAAAATACCACATGAAAATCCTTGATAATTAGATCATTTAAACCAATCCTCAAGATAATTGAGTTATATTTTTTAATTTTTTATCAATCTTATCAATTGTAATTTATATTATTTATTTTTAATAATAACACACTATTATTTTAAAGACAAGTTTCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,144.2 L-21,688.0 L-31,587.4 S-0260.5 S-3328.4
S-6352.5 S-9267.9 S-12250.0 S-15230.2 S-24306.6
C-0622.1 C-24,575.7 C-410,143.3 C-614,064.1 C-811,262.5
C-103,032.4 C-121,241.5 C-141,786.1 C-162,295.8 C-181,507.7