Summary
Transcript IDgene_000015309
Gene IDTTHERM_00399600
Length175 bp
Sequence
CATAATTTGATTTTAGATAGATTAGCATTTAAAATAGCAATATTGATGATAGTATCTTCATACTAAACATCAACTAGCTTTTTATGGAAGGAGAAGCAGAAGATATAGGTGGTACTACTGAAGCCACTTTAGACAAGATAGATGAAATTTTAGATCATTTTGGTTAAGATATGAG