Summary
Transcript IDgene_000015487
Gene IDTTHERM_00502440
Length1426 bp
Sequence
AATATTTATTTATAATATTTAGCTTAAAAGGATTTCTTTGATAAAAATTTACGATAGATTGATTGATTGCCAGAAATGATGCTTAAAGAAAAAGTATAAAAGAATTTAAGTCAGTTAAACGAATTATTTAGCGAGTTAAGTAAAATATCTTTAAATATGAAGACCTATGTAGTTATCCTTGAAGATCTTTATAACTTGCTAGAAGAATCTACATATAAGGGGGATCCATAGGATCTTGAAAGGCGAAATGACTTTGAGGAAATACAAGATAACAATATTTATGTGGAAGATTATTTAAGCTCTTCTCTAAAATATTAAATCGAAAAGGATATAGACACATGCTTCGCAGCTTGCGAGCAAATATATAAAAAGTAAAAATCAAGTCTTCTAAAGAAAACATGGCAATACTTAAAAATATTAATATTTGATGATCCTGAAGAAGTATTACAAAATGAGAATTTCTCCCTTCTATAAAAAGTACTTAGGGTAAGATTAGAATTAAAAGAAAAGAATTTTGCTATCTTGTACAAAGAGATAACTGAATTGAGAGCTAACTAAGAATATCAGTATAAATATAAGCGCATATCTGAAGAATAAACTGAGCATAAGCAATCAAAGCCTTAGTAAAAAATGAATACAGTTTATAATTTAAAAAACAAAAACAATTTAAGTGGTGGTGAGATTTTGGATGAAAAAAGTAACGATAATTAATTGTCTTTTGAAACTCCCCTACCTCCAGATGCAAATAACAAATTTAAGAATCTTGGTTAATATTTAAAACCAAATAACTCCACTTCACAAAACTTCTTTGCCTAATTAAAAAAAGATGATCAAAGTTCTAATAGCAAATCAAAACCAGAAAAGACATAGATAACAAGCATCAAATATAAATTAGAACCATAAACACATGAATCATTATATTGCTAAGATAATTTTTTATAAGAAGTATCTATTTGCAAGATTATAAACTTGAGCGAAGACATGGATGTACATGAATAATATTCCTATAAAGATTTCTATTAATTTAAAAGAGCTTAGTATATTGAGTTATTAAAATCTAGACAATAAGATTTAGGAAGAATTTCTAGAAATCATGCAAGCTTGAGAGTAAAGATTAACAATGACAATAATTAAGTTGGATTTTACTTAGTTAATCATAGTCCAAATGGCACCTACATTTAAAAATCTGGCACCACAGAATGGATTAAATTGAAAGAGGTAGGTCAAGAAAGTTAAATTTTTGAGGGTGATCAAATAGGACTTCTATTTGACAGTCAAGATCCAACAATGTACCTAATAGGCTACAAATTCTAATTAATTGAATGATTTATACAAACTAATATATTAATTAATGTTTATTAATTTTATTTTTATTGCATCAATCAAGTATTTTAATTTGGATTTGTTAATGATATTTTGTTTTTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1534.4 L-2399.5 L-3421.9 S-0413.6 S-3523.4
S-6538.9 S-9614.4 S-12620.3 S-15601.7 S-24596.9
C-0249.1 C-26,345.0 C-41,715.4 C-64,788.6 C-84,644.7
C-101,151.0 C-12843.0 C-141,054.6 C-161,554.0 C-181,232.5