Summary
Transcript IDgene_000015590
Gene IDTTHERM_00537440
Length1901 bp
Sequence
AGTTTTTACAGTTAATTTCACTAAATTAGATTTCAAGGAAAATACTAGTGTATTAGAAAAGTTTAAGCCAATGCTATAATCATAGTAAAATGCCTAAACTAGCGAGAGAAGCAGGGTACTTATTCTCGCTAATTCTTGTGTCCATATCCTATATGGTGTAACCACAATTCTTTTAGTCTCTTTTGCAGCTGTAAAATTAGCTTAAAATGAAACTCATGCAGAAAATGGAATTCAAAAAAACTGGGAAAACAATATGATTATTGACATATAAAGTAGTAGATATGATACTTGTCCTTTGGGATATGAATCTATGTTTTCTTTTGAATGGCCTGGCACAATTCCAGCCTGTAACTGCTAATTATGGAATGAAAATCCAACTCGTCCTCATGGGCCAGATGGAGAATTTACATAAACTAATTAAAATACTCACAATTTATCTGAATAGGATATAGAGGAATAAAAAGAGGAAAAAGAGAGTAAGTCCAATAATCAAGGAAATTTTATTTAGAATCACCTTAAAAAATAGCAATTTAACTAAGAGGATAATTATAAATAAGAAAAATAATAGGAAAATAAAGATGAGAAAATTGGAGATGCTAAGAAATAAGACTTAAAAAAGTAAATTAATCACCCAAAACGTAATAAACTAGACTAGGTCAATGTGGCATATAATTAGCCTAATCCTTATCAACCTTCTAAGGAAGATCTTTTAGCCAAACTTAAAAAATACGGCTAAGAAAATAAAATTTACACAGAAGGAATTTGCAACTGGAATTAAACTTAAGCAGGATGTGTTGATATATAACCTGTAAAATAGCAATCCTTCACCAAATGGAAATAGCGTTTGTAATGGTGTGTAGCTCGTGCATAGGCAGTTAATATGAGCATAATGTAAAAGTATTATGATTACGAAAATGGTATTTGCAAAGATGAAAATCTGAGAGTATGTGGTGATCCAGAAGATAAGAATTATTAGTACTGCTTTCCAAAATAATATACATAATGCCCAATAAATGGAATATTAATAACTACAACTCCTCCTAGAGGATAAGAATAATTATACTATTAGTCTCGTCCTATGCAATTTAGTAGAAATTAGATGTTATACGTAAGTAGAAATTTACCGAAACAAATGCCATTATCTGACTTTTTAGTAGCTGAGGATAGCGTTTGTATAGAAGATCCAAAAAATAATATATCTAAAGATCACTAAGATTATTATCTTCTAAAAAGCTAAAGAAAAAGATGCAGTAGCAACATTACAGATGATCGCTATGTCATAATAGACTCTTAAGGTGAGCAAAGTTTTTATTATAACAATTTTGCTTTACAATACAGAGACTAATTACCTGATTTCACCTTAAATAATACATACATCTATAATTTATATAAGCATCAATACATTTATTGGAAGCATGAATGTGATGAATATATGAGCTATTTCTTATCTGATAAAGATTTCGATCAATTCTACACTAGACAAAGAACTCTGAAAATTATAACTTATGTTATATCAATAGTAACTATAATGATTTCAACTTTTGAGTTGCTCTTAATTTGCAGAGTTCCTATGGTGTTAAGATTTGAAAAAGTCATTCTTTAATATAATCCCGTTATTGTTTTTGTGCTCTAGTTAATAGTGCTTCCTTTTAGTGCAGCAGCACTTCATTAAGCAAATGTACTTTACAACATAGAAAAATAATTATCGTTAAAGCAATGCACAGATGAATTTACTTTAAAGCTGATAGGTACTGGAAGTATTTAAATTCACTAAGAAATAAAAAACTTCAATAAAGGATAGATTATCTTTATTTGTCTAATTTTGCTTGCAAATGCTATCAATTTTCTTTTAACACTTTGCTGCAGCTAAAGCTCTGCTTAACCAAAAAAGAAAAGAAGAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,148.6 L-21,105.1 L-3760.9 S-0243.0 S-3461.6
S-6569.8 S-9472.6 S-12560.7 S-15577.3 S-24468.3
C-0263.1 C-22,270.4 C-4945.2 C-6349.1 C-8882.7
C-10278.4 C-12609.0 C-14857.5 C-16527.4 C-18508.2