Summary
Transcript IDgene_000015617
Gene IDTTHERM_00481260
Length2707 bp
Sequence
GATAAAACATAAGGCAAATTAGAATAATTTGCATGAGTAATTTAAATATACAAAAACACTTACCATGTCATGATTATCACATGGGTTAGTGTCTCTTACCAAAGGCTTAATGTCCTTACAGTCATGATGGAAAGTCTTGGGGTATATGTCCTAACAAAAACCATTGCCCAACACCCCATAAGTTAGTAGATTGTCCTTTATTCTTGAATAATTGCTGTCCAAGAGGTGATAATTGCTCTTACAGACATAAGAAAACTGATGAAAATGGTCAAGAAATAAAAGAGGAATAAATAGTTTAAGACAAAGCTTCATCAGACGAAATCTAGATATAATAAGATAGCGAGAATACTGCAAATAAGAAATAAATTATTAAAGGAATGACCTTAGAAGATTTTAAATCTTCTTTAGTAGAATTAAACTAAGATTTAAAAATTATAATGCCAATAATTCAATCAGAGAAGGATCAATCAAAAAAATGGAATTCCTCTTGTTCTTTAGATTTATGCTTCATAGTAGATATTACAGGATCTATGAGTCCATGGATGAATTAAGTTGTTCAATATGTAGGAAATACCTTAAAAACTATCTATGAAGACTTTCCAGCTATTGATCTCAGAGTTGCTTTTTCAGGTTATAGAGATCATTGTGATTAACATAAATATGTTACTTACGATTTTACAAGAAATGTTGATAGTTTTAGATCATAATTAGCTCAAGTTACCTGCTTAGGTGGTGGTGATTGCCCAGAAGATGTTACTGGTGGTTTACACAATGCTTTAAATTTTGATTGGGGCTCATCAGCTTAATAAGCTGTTTTTATTGCTGATAGTCCTGCTCATGGTGTAAAATATCATGAAAATATAGCTGATGATTATCCTAACGGATGTCCTAATGGAAGAAAGTTAGAAGATCTTATGATTCAGTTTAGTTAGAAAAAAATTGATTTTACAGTAGTTGAAATTAGTGGTATGACAAAAAAAATGTTTAGTATAATGACATAGTGCTATGGATAGAATTTAGTTATCAAGAATCTCTCATCTGGTACAGCAATTAATGGTCCTACATCCTTTTAGCATGTGATGCATGAACAAATAAAATCCACTGTTACTGCTTCTCTATCAAAGAGTGGATTAAGTGGTGGTGGTGGCCCTCAAATTTAAGTATCAGGAAAATCAGGTAAAGCTTTTAAGGCAATTATGGAAAGCAAGAAATTCAAGAAAAACTTTTCATGGAGTAGATCCAAGGAAAAGTCTTCTAAAATTGCATCAACAATTATCCAAGAGCAAATCTAAGAGCAACAAGTTTTAGAAGAAGAAGAGTATGACTCAGATGATAGTGAATATGAAACTAAATTGGAATAGACAGCCTAGAAGTAGTTAAAGTAGGCTATCAAAGATAAAGCTATTAGAATTTAAAAAGAAAGGGAAGAAAGATTAGAAAAATTAAAACAATCCTTCCCTTCACATTATTTTGATACAGTTGAATAGCATGACCAAAAAAACAAAAAGAAATAAAAAGAAAAAATTTGTAAAGTTTAATATCATAATGGACCTTTCGATTGGAATAAATTTGAAAGCTTCAATGATTATCAAGCCATTTGTTACTCTTTTGAATTGGTTAAAAACTATAAAGGAAACCAAGAAATCAATTGGAAGAATCTTGAGATTAAGACTTTCTATTTGGGAACAAAAGTAAGATTAAGCAACCTTGTCTTTTCAGAGGGTGCTATGAGATATGCATATCATGCTAAAGACTTGTATCTCAATTAAAAAATGGTCGCCAAATAATACAAGAAGCCTGAAAAGTAGACTAAAATATCTATTGAAGAAATGAAGAGAGATATTATTTCATAAATTGTTTGCAAGTATATTGTCAAGGAGTTCAATAGTAAACTTGTTGAAATTGAAAAAAGTGAAGCATTAATTTTATAGTTTATTGATTGTTATATCTATGAAACTACTCATCCATACAATTCGAGTCCTCGTTACTACTTCGAAAAGTATATTGATGGAACTTACGAAAAGTTTAACAATAATGCTGGTTATGTTTCTCAAACTGATAACTTATACAGTCCTTTGGCCTAAGCACTTTCTCATTTCTCTTGGTAAATCAGTAAAGGTTATCTTGCTATTGTAGATTTGTAAGGTAATCATGAAGGTATTTTGACTGATCCCCAAGTTCACTGCTTGGACTAAGAAAAATTCGGGGATGGTAATTTGGGCTATGAAGGTATTTTGAGATTCTTCTCAACTCATGAATGCAATGATTATTGCAGAAAACTTTAGTTGATTCATCCTTTTGAATAAAGCTAAATCCCTCTAAATAATACATTCTTCTTAGAATTTAACAATTCTGATCAAAATAGTATAGCAGATGACTCTTAAGCCTTGATGAGTTAATTATGTGATATCTGTTAAAGTGCAAGCTCTTTTAGTATAAAATAAATTATCGAATCTAAAAAGAATAACACAAGATTAGTATGTTTTGGCTGTATAGAATAAATAAAAAAAACTACTTTCTCAAAGAAGTGTGTTCAATGCCCATAATAATTATAGTTTAGTACATACGAATGCATTCAGTTAAGAAGAGATGCCCCTCCTTTGTGCACTTCTTGCTAATCTAAGCAATGAATTAATAATAAAAATAACATTTCAATTAAATTTTAAATTATCATAAAATTAACTTAAAAAAAAAATTTTCAAAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1225.2 L-2119.1 L-3123.4 S-02,209.3 S-32,350.2
S-61,468.9 S-9786.6 S-12596.1 S-15543.1 S-24390.7
C-0897.0 C-2454.0 C-41,223.7 C-6808.2 C-81,061.6
C-101,196.0 C-12609.6 C-14715.0 C-16921.5 C-181,051.6