Summary
Transcript IDgene_000015625
Gene IDTTHERM_00559750
Length2123 bp
Sequence
TGTACTTAAAAAAATTGCATTTAAAAAATATGGAGAACCAATAGTAATAAACAGAATTGAAAGAGACTCAAGTATTGAAGGAAATTTAAGCAGATACTTAGTAAAAATCAGAAATTAAGACTGAAAAGTTAGAAGCTCAAAATTAGCAATTGTCTGAGTCTGAAAGTAAATCAGAAGATCATTCTGTTTTACTTAGCAAAAGTCACCAATATTTAAATAGAAGAGTTGAGTGCCAAAGTTTCTATGGAACAATTAAATACAGCGGACCTCTTTTACATGAAGGAAGACCTGCAAATAGCGAAAATTAACTATGGTTTGGAGTAGAATGGGATGATGAAACTAGAGGAAGACATAATGGAACTGTAAAAGGAACTTAATATTTTTAAACAAAAGATGATAAAAACTCAGGAACTCTAGTAAAATATGAAAAAGTTAGCATTGGTATTGATATTTTAGATGGTATATTAGCTAAATACTTTAAAGAAAATATTCCTTAAAACCTCAAATAGCAAATACAAGATTAAGTTGATAGAAAGTATAAAAAGCAGGTGCTAAAAACTGAAGTTGAGAACCTTCCGGACTCAGTATAATAAGAAATAAATTCTGAGAAGCTGAAAGAGGAGGAAGAGTAAAAGCGTGGTGAAGAATAAATTAAGAAAGTAATTTAAGTAGAAATGGATGAGGAAGCCTATTTTGAAACATTTAAGAAGCATAAAAAGATGGTACAATTTTACGGCTTTGATAAGATTTGGAATAGACTTAATAATATAACTGAGTTGACTGAGATGTCTTTGTAGGAAGTATGCATTTCTGATTTAGGTCATTCAAATTACTTGAGAAGATTGCTTCCAAATTTAAAAACACTCTCTTTGGAAAAGAATTTGCTTTTTGACTGGGATTAGGTTTTCTAAATAGGCTACGAATTAGAATAATTAGAGAGTCTTTCTATCACTAGTAACAAGCTCATGCCATTAGAGAGAAATGTTTCAGAAAGATATTCTAAAGATGTAGAGGAAAATACTCTTATGTGCTGGAGTAATTATACAAGGATTAAAGATGTTACTCCTATGGGAGTATTCCATTCACTCAAAACACTTATCGTAATTGATTGCAATTTAAATTGGACATAAGTAAGTCGTTTCTTGCCTGCTTTCCCAGCTCTAGAAGAGTTGTTTTTATGCAGAAATAATATGACAGATTTTGAAAATTTTACTTACAGAGATGAAGACTTAAAAAATTTAACTTTGCTTAATTTAGAAAACACAGAATTGGATAACATTGAGGGACTTAAAGTTCATTTAAATAAACTTTCTAAGCTCTAAAAACTCATTCTTAACAAGAACAAGTTAACTTAATTGGGTAATCTTGAAGTCTATGAAAGCATCACTCACATATCTTTAGAGTCTAACCTGATTGAAGATCCAATTATTTTTACCTAGCTATCTAAATTTCCCAACCTAACTTATTTAAATATTAAGCATAATCCTATTGGTGATAAGTGTGGAAAATCTTATGTCCGCCAAAGAGCTGTTGCAGAATGCCCAAATCTCAATATAATTAATGGTTCAAATCTAAAGAAATACGAAAGAAAGGACTGTGAAATTTTCTACTTGAGAAGAACTTTTGATGACTATTTTAACCTAACTGGATAAGTTTATTACAAGTATAATCTTTAGTAATTCCTTGAATGGGCTGCTAAGGAGCATCCAAACCACGGTAAACTATTACATAAGTATGGTAACCCTTACGAGTAATAGCCAGAAGAACCTAAAAATATTACAGAAGACTCAGCCCCTAAAAATGTCATGGTTTAGTTAAATCTTATAGCTGCAGCAGGACCTCAACTAGGAAAACCTAATAAAAGCAAAAAATTCCCTGATAACACATCCATTTTAAGCTTAAAAAATGTTTTAAGCAAGTTATACGGTATTCCAAACGACAAGCTAATTTTAAAATACAGAGTTAACTAGCATGATCCAAATGAAATCTTAGATGAAGATCATAAAACTTTAGGTTTCTATGGAATTAAAGATAATTCAACTCTAATAGTCGATTAATTAGATTGATAATCTAAAATGTAACTACTGAATTTTAATTTTTCAAAATAAAAAATGTATCCAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,961.0 L-24,370.5 L-34,420.9 S-05,256.5 S-37,776.5
S-69,945.7 S-911,503.2 S-1214,695.1 S-1517,647.1 S-2420,204.0
C-04,372.6 C-27,116.8 C-44,026.8 C-61,924.4 C-82,362.8
C-101,855.7 C-122,400.5 C-144,544.6 C-167,319.4 C-188,396.0