Summary
Transcript IDgene_000015931
Gene IDTTHERM_00545860
Length1525 bp
Sequence
GATATTGATATCATAAATCATAAATTAAATAAAATATAGTAAGCAAACAAGCAAGCACTAAAAATAACCAAGTGGAAGCCAATATAAAATTTAATAGAAATAAGTTTAAAAAGCAAAATCTAGGTAAAATGATTTCACAGATATTTATTTTGTCTGCTAGAGGAGATATTATTATCAATCGTGATTTTAGATCTGATTTAGTCAAAAATACTCATGAAGTTTTCTACAGATAAGTTAAGTTGTCAAAAGGAGATTGCCAACCTTTATTCAACATTGACGGAGTTAATTTTAGCTATTTGAAACGTGCTGGTTTATATATAGTTGCTACTTCTCGCTTCGATAACTCACCCTCTTTTATTTTAGAAATTTTAAATAGAGTTTGCACTGTCATTAAAGATTTTTGTGGTGTTTTGAGCGAAGAAGCAATCCGTAAGAATTTTATTTTGATTTACGAATTGTTAGATGAGATGATCGATTTTGGCTATCCCCAACTTATTTAAACTGAGTAAGTTAAACCTCATATCGCAAACGAGCCCATAGTTATCAAGAAGTAAACTCTTCCTACAACCACCACAGGAAGATTAGGTTCTCTCTTTAATTAAGGAACTGTTTCTTCTATTGCCACCAATCGTCCTGTAAATTCATAATCTAAGAAGAATGAAATATTCGTTGATGTTTTTGAAAAAATCAGTGTTCTTTTCAACGCTTCAGGATATGTTATTAACTCCTCCATAGAAGGATGTATTTAAATGAAATCTTATCTTAATGGAAATCCTCCTTTGAAACTCGCCTTAAACGAAGACTTAGTTATTGGTAAAGGTGAGAATGGCAGAGTAGTCTTAGATGATTGCAATTTCCATGACTGTGTGAACACAAATGAATTCGATTTAAGCAAAACTTTGAGAATCTAACCTCCTGATGGTGAGTTTGTTGTTATGAATTATAGAGTTACTTCAGAATTCTAAACACCTTTTAGAATATATCCAGTTATTGAAGAAATATCTAACTTCAAGCTCGAGTTGCATTTAAAGGTTAAAGCATGCTTCCCTAAAGAAATATTTGCAAGTTACGTTACTTTGACATTCCCTATGCCTAAATTAGCATCAAATATCACTAACGAATTAGGAAAGAATGCATCAAATTAAAGTGTTGATATTGAAAATAAAGGAGATGTTAAAATGGTAAAGTGGAATATTAAAAAATTCATGGGTGACACTGAATAAGTATTAATAACAAAAATTACTCTCTAATCAAGTGCTAATTCATACAGTGCTCGTAAAGAAATTGGTCCCATTAATGTCAGCTTTGAAGTTCCTATGTATAATGTATCTAATTTACAAATTAGATTCCTTCGTATTGATGACAAAGAAAAGAGTAATCCATTTAGATGGGTCCGTTTCATCACCTAGTCATCTTCATATGTTTGTAGAACTTGATATCTTCACCTATTATGAACTGATTCATTCATTTACTCGTTAATTTTTAAACCAAATAAATAGCAAATTTGATTCTATTAAAATTCAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-16,521.9 L-26,286.4 L-35,940.0 S-05,227.6 S-32,801.5
S-63,584.5 S-93,241.1 S-123,930.0 S-154,443.6 S-243,929.4
C-01,570.1 C-22,367.4 C-41,234.8 C-61,387.7 C-81,304.0
C-102,000.5 C-121,688.6 C-141,836.2 C-161,825.5 C-181,907.6