Summary
Transcript IDgene_000015941
Gene IDTTHERM_00543580
Length1255 bp
Sequence
ATAGCCGGAAATACAAGTTAAACACATATTAGGTTAATTGGAACAAGAAGCACAAGGAGAAAGACATTTCTAACATTAGTTTTTACTATCCAAATATTCATTTGATTTACAATCAGGAGTACATTTACCACCTGTAGCATCTAACTTATATCCTTATTAGCAAGAAGTACAAAAATCTTAATATCTATCACATGTCAAACAAGAATTATCACATTGAACACATTCTCTTCTGTTATTTAAGAATAGACCATCTTTGCAGGAATAACAAGCAAGGGCATTGTTTGGTTAGCTACATTCCTTACAATTAGGATGGCATTTCTAATTGCTTGAGTTTTTAATACATCTTTATGTCCTAGAGTCTAAAGTGTATTCATTAGCACATTCAGTACATTAATCTTAGTAGTTTACACATTTAGAGCAAGATTCACTACATCTTTAACATTTACCTTATTAGTTCTTGAAATACCCATCTTAGCATACTTCATCATAGCAAAAGGATTATATAAGGAGAAGACCAGGTCTACAACTGGTACATCTATCACTTTATTACTCGCAGGTGTTGCAAAAAGAATGACAAGGCTTGCATTTATTGTTTTAATCTAAGAATTACCCATCTTTACAACCTGAAATACAACTTGAACACATGTAAGGTTAATTGGAACAAGAAGCACAAGGAGAAAGACATTTCTAACATTAGTTTTTACTATCCAAATATTCATTACTTCTACAAATAGGTGTATTCATAATACAGATTCCAGTTTTTGGATCTTTTAATAAGCCATCTTAACAAGAAGTACAATTTGTTGCTTTTCCCGAGCAAGTTAAGCAACTATTATGGCATTATTGGCACTGGTTGTTTAATAAAAATTCATTGCTTTAGCAAGAAGTGCATTTATTAGGACCAAATTCGCAGGTTTAACACTTATTGCTGCAATACTAACATTTTCCAGATGATAAATACATTCCATCTCTACAGGAAGTACATGAATTAGGATCATTATTTTAGCTGCATTAATTACAACTTTCATGACAAGAATTTGTATTTGGAATACAATAATTGATTTGAGCATTATAAGTATAGCCAGAAATACAGCTATAACAGAAATCACTCTAATACTAGCAAGTGGCGCAAGGAGATACACACTTTTAGCAGCTACCATCTGTATCTTAGTACTCACCTGGGTTACAAACACTAACACAAGTTTACTAAGAATGATCAAACTTATAACCTGCTACGCATTCGATACATTTTGTA