Summary
Transcript IDgene_000016289
Gene IDTTHERM_00755920
Length4585 bp
Sequence
AATTAATTAATTTTATTTTAGTTAAAGATAAAGCAAATCGATCTTTAATAGTGTTATTGTATTAGCAGCATCAGTAGAAAATGTTCTCAAGTTAAGTATCATAAGAGAGCTCAATTTTTAGCTAATCTAAAGTATTGCCTGCTTTTAGTAACTTTGGAGCTTCAAATAGTCAACAATAAAATTCAATTAATTTGAATTTTGGTTAGCCTAACACTCTTTTTTCAAGCTAAATGGTATAAAATGCACCATTTTTTAGTAACAAAAGCAGCTCTATAGCCTTTGATGTAAAAAAAGAAGAAGTAGAATAGCAGGAAACAACTTTAGATCCTTATATTTAGGAGATAGAAAGAAAATAAAAGTTACTTTAAGAAGCTAAAACAAATAAAAAGTTAAGAGAAGAAATCCTATAATAAGAAGATGTATTAAAATCAAATCCTAAACTGCAGAAAATCGATGAAGCAATTAATAAAGTAATATCGTAGACTGATTAATTTATCGCTTTAATTTAATGTAAGGAGGAGAACTACATGTTTCCTAAAAGAATCGAAACCATTTAAGGAGAAATATAAAAAATTTCAAATGGAATAAAATATGGTAGCAATACTTCCTAGTTTTAAAAAATTTTAAGTGAATTAGGCTATTTATGTTGGTAAACTTCTAATAATTTGGAGTAAGTTTAAATTGAGATGAGAAGAATACAAAAACAGATTAATGAAGGTGATTAAAATTATTAGAAAAGCTCACTCTCTACAAAAAGTAAACAATAAATTGATAGTAATTAGTAAAATAAAAAGATATTGGAAGTTTTAGATGTAAAACTTAACTTATTAAAATGCATTTTAGATGAATTCAACAAGAATATTGTATATGTCAACAATTCTAAAGAAATAAATGAAAAGAAAAATTTAGAAAAAATGATAAGCAACATTAGTTTAATTTAATAGGATGCAGCTACTTAATGCTTTCAAACATAAACTCTAAATAGCAAAATTGAAGATAAAAATAATTCAGAAATTCAATTATTTTTAGATGAAAGTATCGATGTGAAGCTATAGGTTCTAGAAAATATGATAGTCTCTCGCTTCAAAGAGTTACATGATAAAGTTATTTAGCTTGACATATAGTTAATAGATAACTAATAAAAGTAGAAAGAAGTTAAAGGCAGAGTCGACCTTAGTTTAGATAATATTGATTTAGACACAACTCAGGTCTAAGAAAACTAATATCATTTACTTCACTACTCTTATGTAAAAACTTAGGAAGAAAAAGAAAGTAATCCCACTTTGTAAAAGGATCGTATTCCAAATATAAAGTTAGCAGGTCGTGTTACAATTGCTGATGAGGTTGAACTAAATCAAAGTTAAAAGAAAACTGTGGCATAGAAAAAGTAAAAGAAGGAGGTCGAATTTGATCTTGATGAAAACTTCAGCAGTGATCCTGAATAAGAAGAGATCAGCTAAGACGATTTTGCAGAAATTTAAGTAGATCCATTCGAAATCTAAAAAAATTTTATTTAGTGCTAATCATCTATAATGCATATTAGCAAAGTAGGGGGATGCGTTAATTTTTCCTAACCTTAAAAAGCTTAAACTGATGATTTACTATTCAAAATTTAATGCGATAACTCTAAAATTCCTATCCCTCATAACATTAAATTTAGGGAAAATCTATTTAAATCATTGAAGTCCTCAAAGAAGTTATCTAAATCATAATAAGATAAAGAAATTTACTTAGGTGAAAATCATTACTATTTGAGTAATAAATTAATAATTTAAAATTTATTAACTCCCTTATAATATGAACATTTGGGAAAAGAGGCCATCACAAAAGAAAAAATGAAAATAATAGTTAATGAAACTTAAAAAGTGCACAATCCAACTAAGGAAAATAATAATATTAATCTTAATCTTAATGCTATTGCAGAAAATAAGCTACCACAAAAGTCAAAAGGCGATGAGACTGTAGGAAGAATGGTAGCAAGTATTAAAGAAGGAGTGCCTTCACCTAAAACAGAAAAAATTCCTTCAATAATGGTCAAAACTAAAAAGGCAGACTCTTTTACTATTAATGAAAGTGAAATTAATAATCCTTTGGATTCTGATTCATCTGATGAAGAGGAATATCTTTAAAATGTTTCTTAATTGCAAGTAAAAACTGATAAAAAAGACCAACTTCCCGCTAATATCTTAGGTAATAGAGGAGTCTCAATCAATTTACAAGAGGTTGAAAAAAGTAACACAAATAAATAGTAATAACCAGAATTACCAAAACAAAGTAATTCACTTTTCCAAAATGTTAAAAAAGACAATACCAATGAGTAAGCTTAATAACAACAAAATAAAAATCCTCCTAATTTGATGACATAAAATCAATTTAAGCTAAGCAGTAATTAAGAAAGCTAAGCTATATAAAATACAAATTAACCTAAAACTGAAACTCAACAATCAAAAAACCCTCAAACAAATAATCCTCTATTTGGAAATATTAACAAAGCTACTACATTCCCATAAAAAGATACTCAGAGCTAATAATAGTAAAAACAAATATCTAATAACTCACTTGCTTCGGCCCTTGTTTAACCAAAATAGTAATAGTAGCCTTAATTAGGAATAGGTATTAATCTTACAAATTAAAACTAAAATGAAAAACCTAAAGCTTAAGCTGCTGCAGCATAACCTCCTTCATCTCCACCATAATCTTAAGTTTAATAATAAGTATCATAAGGTTTATTTGGTTAAAATAAATTGTTGCCAAAAAAATAGGAAGATAAATCTGTAGACTTACTTTAAAATTAATAATAAAAGCTAAATGACTAATAAAAAGCTTAGATAGCATCATAACCTCCTTCTTCACCATCCTAAGCTCAAGTTACTCAGTAGACTAATTAAAGTTTATTTGGATAAGGATTAAATGAACCTAAAAAAGTAGGAAATATTGTAGATTAATAAACAACTTAACAACCTCCAACTACCTCTTTATTCTAAGCAAAATAATAAAATCAATAAGGTTTATTCAATTAAGGTACAGCAGCAATATAGCAATAACCATAATAAAAACAATAGTAACAAAAGGCTTCTTTACCACCTGATTCTCCACCTTTAGATTAAGTTAAAAAGTAAACTTAATAAGAAAAATTTGGAATGTCTGCACTTAATTTAAATCAATAAGCCTAATAAGGCACTGAAAAAGCAAAATAGTAAGTATAATAACAATAACAGTAAAAGGCTTCTTTACCTCCTGCTTCTCCTCCTCAGGATTAAGTTAAAAAGTAAGCTCAGTCAGAAATGTTTGGTATGTCTGCACTTAGTTTAAATCTTTAAGCTTAATAAAATACAGCATAAGGAGCTTTACCAAACTTATAATAAAAACCTGAGGCACCTACTGCTGCTGGAGAAAGTGACAAAAACAAAAAATTACCACCAGCTCCTTCAAATTTTAGTTTAAACAGTTATCCAGCTACCTAACAGAAAACAGGAGGTTATTTTAACTTTTTGAATAATAACAATACATAATAACAACCTTAAGCAGATAATAAATAAGAAATAAAACAAGATGTGCCTTAACAAAATAATGAAGTAAAAATTCCAATATTTTAGGTTAATAATAATAATAGTAATAGTTTATTAAATCAGTAATAAACTTAAGCTGACAACAAATAAATATTGGAAACAGGTATTAAATAGCCTACTCAAGGTTAAGGGTTAATTAGCTTTGCTAATACTTCAAACAATAATAATGCAGGTGGAATGTTTGGATAAAAAAATAATCAAATTCCAGCTTTTAATCAGCAACCTGGTATTATTTAAAACCAATTCTAAGATAAAGAAGGTGATGAAGTAGGTATTAAAAAGAAAAGGCTTTCAACCGAAGATAAACAAAACAACTAGCAAACATCTGGAGCAACCAACTAATTTGGAATGTTTAGTTAGAATAACTAATTTAGCTTGAATAATGCAAATTCATTTTAAAATTAACAAAATTAAAATGGAATGTTCAATAATACTTTCCCATAATAATAAAACAATAATAATTAGTAAGCAAGCGCTTTAAGCAATATTAATTTCGGAAATGCCAGCGGTTTAAATATGTAAGGGGGTTTGTTTTAAGGTGGAAGTAAGCAAGCTTTAAGTGGTAACACCAGTAGTCTTTTTGGAACTCAAAATAATAATAACAATCAGAATATGTTTGGTTTTGGTTAGCCATCTTAACAATCAGGTCTTCCATAAGCAGGATTTGGTGCTGGTAATTCCGTATTCGGTTTTAATACCAACAATAATAATCAATAAAATAATTAAGCCTTCAAGTTAGATCCTAAAAATATTTCATTTGGGTCGTTTGGTTAGAATCAATAATAATAACAACAACAACAACAATAATAATAACCTAATTAATCATCTAATATGTTTAGTAATTTTGTTTAATAAGGATAAGGTCTTTTCTAAACAGGTTAACAAGGTAACCCTATGCTTGGAGGGTAAGCCAATACCATTACACCTGGTATTAATAATACAAATAATACTGGTGCTTTTTATAGACCAAGAAAATGAGATAAATAAATATTAAATTTCTAAGATAATTTATATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,536.5 L-21,944.0 L-31,678.4 S-0949.9 S-3848.0
S-6627.7 S-9621.5 S-12592.1 S-15633.2 S-24928.6
C-01,684.1 C-21,815.8 C-410,611.1 C-68,175.7 C-85,782.6
C-101,846.2 C-121,103.6 C-141,877.3 C-161,613.6 C-181,661.7