Summary
Transcript IDgene_000016509
Gene IDTTHERM_00693060
Length1043 bp
Sequence
AATATTTATTCATTTGAAATATAATTTTTGTATAACAAAATTAAAAGATATTTAAGATTCAACATTAGAGTGATTTAAAATGCTAAATAAGTCATCAAGCTTGATTAAAAAATGTTTTGGAGTTGTTAATAAGAATGACAACTTCAAATATGAAGTTTTAAACGATAAGAAAATAGGTATCTTAACATTATGCAATCCCAAGAAAAGAAATTCTTTGAGTATTTAAATGGTTAAAGATTTGTCTGAATAATTTAAGGATATAGCTGCTTAAGACTATGCTAGTCAAAATTATGCAAAAGTTATCATTTTAAAGTCAGAAGGAACTGTATTTAGTGCAGGTCATGATTTAAAAGAAATCAAAGAATTATAAGATAAAAATGCACACGAAGAATAAAAATAGTTATTTTAGAGATGTGCTAATATGATGGCATATATCTAATAAAGTTTGCCTTAAATTACAATCGCTTAAGTACACAATTTCGCAACAGCAGCCGGGTGTTAGCTAGCATGTTCTTGTGATTTAATTGTAGCCTCAAAAAGTGCTTCATTTAGTTGCCCAGGAGTTAAAATTGGGCTCTTCTGTTCTACGCCAGGAGTTGCTCTAATAAGATCAATGGCTAATTAAAAAAAAGCTTTTGAAATGCTTGTTACAGGTGATCCTATAAGTGCACAAGAAGCTTATCAACATGGTATGATTAATTAATATGTTGAAAATAATGAGGACTTAGAAAAGGAAACTTTTAAGCTTGCAGAAAAAATAGCTTCTCATAGTGGAGAAACATTAGGATTTGGAAAGCAAGCTTTCTACAAATAAAAAAACATGAATGATTTAGGATAGGTTTATGATTTTGCAAGTTCTGTTATGGCCTAAAATTTAAGAATCGAAGATTGTGTTGAAGGAATAAAAGCCTTCACTGAAAAACGTCATGCCCATTTCAAAAAATGAATCTAAAAATAAAATAAAATATTTAATAATTAATAATAATAAATGTCTTATTTTATGTGAATATATTTTTAAAAAAAATTGAATTTAGTAATTTCGA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,590.5 L-25,927.4 L-37,421.1 S-05,563.4 S-37,783.7
S-66,893.1 S-96,689.3 S-127,349.2 S-157,260.2 S-245,343.0
C-01,986.7 C-28,163.8 C-46,319.9 C-63,961.0 C-83,619.3
C-103,815.2 C-124,832.9 C-143,795.5 C-163,531.8 C-182,969.8