Summary
Transcript IDgene_000016526
Gene IDTTHERM_00919680TTHERM_00919690
Length3331 bp
Sequence
AAGTTACCAAAAAATAATTCTAATGAGTTGATAAAAAAATCTAAAGAAGTTTGCTTAAAAGAAGTTAAGAAACTAATGAAAGCTAAAATAGAAGAAATTACATCTGATTTTGTTGAGGAGCTCCAAGCTAATGATAAAAAAATATAAGATAAATAAAGTATAAATTTTATTTATGATAAATATGAAGATTTCGTTATTGCCTTTAAAGATGGCCTAGAAAACGATAATGATTCTAAAGAAGAAGATTTAATAAATCAATGTAATAAAATCTTAATAGAATTATAAGCTATGAAAGAAAACTACAAAAATATTGTTAAATTTAAATACAACACTTTAAGATTATAACTTCAGAAATTGATGTTTAAAAAAGAAAAACTGATTACTTCAATTTAAGCTTTTACGAAAATAAATCAATTGACTTTAACTTTATTAATAGTGTTCTCTATACTTTCTGTGTTTGAGAATGTACCTTTAGCTAGCTCAGTAGGGATAATTTTGATTTCTCATATACTTTACACGATATACAAGCTAAAATGATAATTAATTAATAAATAAATAATATTTGATAAAGTAAAAATAGATAATTCTCATTTAAACTCAAAACACTCACTACATAGATATTTATATAAAATGTACTTTTATTATTAAATCAATTTATTAATTCAAATTTTCTTATTTTTAAAATTAATCATTTTCTTCTTCTAAGTCTTTAGGAGGAGCTCACTGGTTTTTTCGAGGTTTCTATTTATTATTTTTATCTTCTAGTTGTTCTTTAGTTTGCTTATTGATCTTCTTCATCTTCTTCCTCTTCTCCTTCATCTTCACTTTATGAGTCACTCTATTATTTTTCATTTTTTTTTCTACCTCTTCCCCTAGTTTCTTTTGCTTGACTTTTGTTTGCTGGTGATTTTTTAGGTCTTCCTCTAGTCTTAGTCTACTCTTACTCTTCCTCCTCTTCTTCTTACTCTTCATGCTCTTGTTCAGAAGACTCGTTCTCTTCCTCATCTTCATGTTCTTCCTCCATTTTATTTCTAGAACCTCCTCTTCTTGTGCTTCTTACAGATTCATTCTTGGTAGGCTTCTTTGTATCAGCTTGTTTTCTACCCCTCTTACGAGTAACCCTAGTTTACTCTTCTTCATCTTCCTCTTACTCTTCTTCTTCATTTTCTTCTTCTCCTTCAGACTCTTCTTTATCAGAATTTTTATTAGCACTATTGTGTCTAGTTGTTCTTTTCACTGCTTGAGTAACATTTTTTGGTTTTCTTCCCCTTCTTTTTGTCTGCTTATCGTCCTCTTCTTCCTCTTATTCACTTTCATTTTCTTATTCTTGCTCACTTTCGTTTTGCTCATCTTATTCTGATTCAGGTTCTTTAGGTTAAGCTTTAGGTCTTCCTCTTCCTTTCTTTTAAGGTTTTTACTCCTCTTGCTCCTCATCTTCACCACTCTCTTCATTATCAACGGATTTCTAAGAAGATCTTGTTTTTGATTTTTTTTAAGCTGGTGTACTTTTTTTTGAGCTTCCTCTTGTTTTTCTAGGGGCTTCTTCTTCCTCCACCTCTTCTTCTTATTCATCAGATTATGAATTATCCTATCCTTCTTCTTCTTCCTATGATTAAGTCTTTTCATTTGATTTTTTAGGACGGCCCCTGCCTCTTGTTTTCTTTTAAGACAATTCCTCTTCTTAATCTTCGTTGTCTGTTTCTTTATGTTCCTCATCACTTTCTTCAGATATTTTATTCTCTTTTGATGCTGATCTTCTACCTCTCCTGTTAGTTTTTGGACTCTCTTTTTCACTTGATGAACCCATAGATTTAGTAGAAGCTGGTTTTCTACCTCTTCTTCCAACTTATTTTTTATTCTTTTTATCTTCTTCTTCAATGTCTTATTCTGCTGACATGTCTTCTTCTTCTTATTCATCGTCTTCTTCATCTTATTCAATAACTTCATCTTACACATCTTTTTTCTTTCTTCCTCTTTTGCTAGTCTTTTGAGCAACATTAGATTCTGGTAAAACTGTTTTTTAAGCTCTTCTAGATGATGTTCTTTTATTTATTACTTCTTCTCTATCTTCATCATCTTCATCTTCTTCTGTCTCTTAATTGAGTATATCTTCTAATTCTTTAGCATTCTTTGCTTTCCTAGTTGCAGAGTTTTTCTTAGAATCTTTATTTTCTTATTCTTCTTCCTCTTCATTATCTTCTTCTTCTTCCTAATCAATATAGATAGCTTTTTTCTTTCTACCTCTCTATGATGGAGCATGAGAAGCTTCAGAGATATCTTTTTTAGGTCTGCCTCTTCTTTTTGTTTCTTCTTAGGCACCTTCTTCCTATTCATCATCATCTTCTCCTTCTTCCTCATCGTCTGAGTTAGGGTGGATAGATTTTCTTTTAGCAGGTCTACCACGTTTAGGCTTTTCTTCTTTTTCATTATCATCATCTTCTTCATTATTTGCTCTTTCTTCATCTTCTTCATCATACATCATAGCTCTTTTCTTCTTTTGCTCAGCAGAGTCATTAATCAACGTTCCATTTGAAAAGAGATTTTTGACAATAACTTCAATATCTTGTTGGTTACCTTCAAATAGTTCAATAATTTTATCACAAATCTTTAATTGTTTTGCATTTAAAGTATAAAGCTTTTAATCTTCATCATTCTTTAAGCCATTTTCACCATTTTCTGCATCATTTGCTTCTTCTTTATCACTCTTTTCTTTACCTAAAACTTTATTTAATTCTTCTTTTTCTTCATCTTCTTCTTATCTTTCATTTTTATCTTGAATCTTTATTTTGTCTTTAATTACTTTTTCCAATTAATTGAACTGTTTACTAACTGGGCAATTTTCGATAGCTTCTTTTAAGAAGTGAAGAATTATTTATAGTTACTCAGTAGTGCACTTATTGTAAAAGTCAAAGTACTAAGTAATTTTTTCAAAAAGAGATTGGAAGCGTCTTTCTTTTGAGCATTTGTATGCCAAGAAAAGGAAGAATCTTTCTTATGGAAGAAATTCATTAGAAGAAACGTTTTTAAGCACTTCAGTGTTATTATGATATTCATAGGACATTAAGTTAATTCCAACTCTAAGAGCCTTTGAAATAAACTTTTCATTGCTATGATCAAAAATAACATATTCATCATTAAAAACTAATCCTTTCTTCTCAAGTGTAACCATCAACTACGAGAATAATTCCAAAGCTTTTTCAAATATTTGAAGATTGTAATAGTTCGAGGCAGTGAAAGTCTTAAATAAAGTTGAAAGTATCTGAATAGCCTTAAAGCCTTATTTTGTGCAGATTTTAGTATCAAACCAAATAACCAAAAGTAAGCAAATAGT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,380.9 L-22,886.4 L-32,971.7 S-01,671.8 S-32,403.4
S-6859.9 S-9992.3 S-121,150.8 S-151,212.2 S-241,785.0
C-01,278.3 C-210,595.7 C-414,131.9 C-615,540.2 C-821,243.0
C-1011,226.6 C-127,476.7 C-147,515.7 C-167,929.6 C-184,321.5