Summary
Transcript IDgene_000016949
Gene IDTTHERM_00568030
Length249 bp
Sequence
AAAAAATATTAGTACAAAGCTAATTAAATAAAAAGAGAAAGAAGAAGAAGAAAAAAGTATCATTCTTACAATGAGTTCTGCTGTTGAAAAGAAAGATCTCCCTGCTGACTACGGCAAAATGCCCGCTGGATACAATTTCCTCACTAGAGGTAAGGACTGGAGAGAATACGACAAAGATTTTATCTTAAGAACTGATGCAGTTTGGGAAAAGTTTTAATTAGAACACTTCTTCAGAAACTATATGAAGGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-120,659.0 L-218,908.6 L-324,815.9 S-015,368.2 S-39,538.7
S-65,535.6 S-95,090.4 S-124,340.7 S-154,320.8 S-243,472.6
C-02,144.4 C-22,702.8 C-42,133.9 C-61,556.1 C-82,736.3
C-103,678.0 C-123,480.7 C-143,521.0 C-163,384.7 C-182,744.6