Summary
Transcript IDgene_000017112
Gene IDTTHERM_00122460
Length453 bp
Sequence
TTTCAATTCATTTACTAAATCAAATCAAGATAGTTAGCTTAAGTAAAGGTTTTAATAGATGGCGAAATATATTAAGTACGGAATTTCTGCAACAATAATGTTTGGTATTGTCACATATGGTTCATACAAATACCACTAGATTAGATCATTTGAAGAAGAATATTATAAAAATTCGAATAGAAAAAGATAGTTTTTGTTTAATATACACTAAAACCTCGCTATTTTATATGATAAATCAGTGGATTCCTACGAAGATCTTTCAAAAATAAATTAATACCGCAAGATTCTTCTTTCTTATGCCTAAGGTTTTGTATTAGAAACAGCTATTGGAACTTCTAGAAACTTAAAATTCTATCCTCCTGGTGTCAAAGTGTTAGGAATAGATTGGAGTTCTAATATGTTAGAAGCAGCTATGCAAAAAAGTGTAAATCACATCTCTTACTCTTATAAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1740.8 L-2684.2 L-3464.9 S-065.9 S-333.5
S-633.2 S-951.2 S-1250.8 S-1542.8 S-2469.1
C-043.0 C-244.7 C-434.9 C-639.9 C-861.1
C-1098.6 C-1266.8 C-1439.7 C-1634.9 C-1836.1