Summary
Transcript IDgene_000017142
Gene IDTTHERM_00393080
Length1124 bp
Sequence
ATATACATACATATTTATTTATTTATTATCAATTTTGTAAAATGGGATAATCATAAAGCCAAGAAAATGAAGACGAAAAGGAGGATAAGACACAGAATGAGAAAAAAAAGTCAGAAAAAATATAAATTAGTCCTTATGTAGATGGAATGCCCGTTTTGCAATCTAAGTTATAAAAATTAATTAAAAAAGAAGATAATGAGAAATAGCAAAATAATGAAGTGTATCAGATGAAAGAAAGCAAAGAAATAAACACAGATATCCATTAGGAAATACAATTAATCGAATAAAATAGGTTCTAAAACTGCAGTGATCATATAAGACAAGAATTTGAAAGCTTTTCCAATGAAAATAAGATGAGTTAGCGCAAGTTACTCGAGTATTTCGGACTCTAAGATCTTGAAAAGCAAAGACTAGGAACTAGGTTTTTCTTAACTTGTAAAAGCACATTAAGTTAAGAAAAGACAGGCCCTTATCTAGACTACAGCAAATTCTTAAAAACATTATCGATGCTCTCTGGAAATAATGAAGATGGGAGATTTTAATTTTTATACTAGCTCTTTGATATAAATTTAGATGGTAAAATTGAAAAAGATGAAATGAGAGACATCCTCCAAATGATTCTTGATGCTCTACTGAGCGTAACTTATGAAGATGATGACTTGAAAAATTTATCAAAGAAAATACAAGGAGAGTAAGAAAGGATGATAAGTTTGGCACTAGACCAGATAACTTCTGAAATATTTGACTCGGCAAATGAGTCAAACAGTATTAATTTTTAAAAATGGAAGAATTGGATATCCTAAATAGAAGGGTTTTAGTAAGTTATAAGGTTTGATCCTCAAGCGAATAGCAATAATACTTACACACAACAAAAAAACTGAAATAATTTAACACTAGAATTAAAGAAATTTTCCCCTCTAATAAAAAAATCAAATAAATAGCTAATAAAACATATTATATTATTACTTCATAAAACTTAATAAAAATTTATATTAAGCTCATTTATTTCCCACGACATCCGCCCACGATATGTTAAAAATACTCTTATTAATATAACTTGTCTATCTATTTATTTATATTAAATTTGTGGTGATTGACTGGCATATCTAATTATTCTATCAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1908.5 L-2791.3 L-3987.5 S-01,155.2 S-3547.2
S-6907.8 S-9942.5 S-12815.9 S-15760.9 S-24815.2
C-01,178.0 C-21,777.1 C-41,114.3 C-61,225.8 C-81,065.2
C-101,132.8 C-121,073.9 C-141,926.3 C-161,499.3 C-181,256.3