Summary
Transcript IDgene_000017157
Gene IDTTHERM_00391520
Length2464 bp
Sequence
CTGTTTAGTAGGTAGATATATTTTCTTTCATTCAAAATAAGGTAAATAAAAACATGGGACTGTAACAATCAAAAGGAATCATTAACCCCACACACAAGGTTTAGGATGATGATATCAATTTAAGAAGGTAGAGATCTTTATTTTTCCCTTTAGGTGAAAATAGACGCATAAAGACAATTGACTACCTTCTAGTTGCTTGCGATACTCTTGAAAGTGGTGGTGTCGAAAAAGATTAGAGTTCAGTATTAAATAAAGATTTGTAAGAAAAGAGAAAAAAACTAAAAGCTACTTCATCTGCTAATCTGTAATTGATTGAAGAAGCCTTTAAAGAGTATGATTACAACTACTCCAAAAGCAATGTAGTTAAAATTAACTTTTAATTGCAGAAAAAGTCATTCGATGACTATCTAAATGATTTATTTAGTAATTCAAACACCAATGGATTCATCCTCTATTTTACTGGACAACTTACTGAGGCTTAGTAGCTAGTCATCAATTAGACAGAAAACACTGCTGTTTTCTACGACTTTAAGAATATCATTAAACGCTGGCGTAGAGTTCCCAATTATACCAATAAACATCTTTTAATTATAGTCGATGCTGAAAACTCTGGCTCCATTCTTGCTTTGAACAAAAAAGTACATTTAGAAGAATATGAGGATATCTTTGGATTAGATTAGACAAATGAAAGCGAATTCAAATACAGAAGAGATCCTACATTTAGTATATTCGCAAGCCAAACTCAGAGAAGCAAAGATAAAGAATTTTACTTAGGTGAAAGTCCTAATAACAATTTTTAAGGAGACTTTAAGAATAACACAAGATTACAAAACAATGGAAAGGGTCCTAATAGCTTTAATGATGCTTCTGTTAACCATGTTGAGATAGATAATGAAAAAATGCAGAGTTACATTCAAGCATCAGGCTTTACAGCTTTATTTTCTTAATATTTAAAGAGTGGAAAACCCTCAAGTATTACTGATATTGCTAAGGCTAAAGATATTTAAACCGTTTTAAATGATAATGATCCTTTCTTCTTCGGATTTATGGTCAAGGCTTACCTCGATTTTGGTATCTTCTTTTGGGCTAGATACTAGAAAATGATTAACTAACTTGAGTTAAATTGCTATGTAGCTGTTGGATTGACAATCAAAAATTCAAGTTAAGCAAATTCAAATAATGAAAAAATAGGTTAATTTACTTCATAGATATATCAAGCCATAACTGACGACTAGAAGTTAATGTTAGCAAAAGATTTAACAGAAACACAAAAAGTGTAAGGTCTAATGAGTTCCCCTTAAAAATCAAAAGTTTCCACACTAGCAGAGTTAGACAGTAATAATTATAGCGATTTAGAATCGAAGTTACTTCATAACAGTGTAAAAGGCTAGTACTTTGGATTTGTTGGTATTTTGAAAAAGGATAAGAAGTTTGGTAATCCATTATTTTCGAAACCAGCTTAAGCACCAAAAACCTCAAACCAATTAAATTTGATTAAGTCTATTGATAATCTAGATGTACCAGAGAGCAACAATAATCTCATATCTTCCCTCAATCACCTAGAAGTAAGCTCATTCTAATCGAACAATGCCTTTAAATCCACCATACTTAGAGGAAATTAAAATTTAGATGAAGGAAACATAGTAAGAAAGCATTATGGAATGTAAGAATACTATAAAGAAATCGAAGGCCAATAAAATAAAAGCGAAGCACAATTTTCTGAATTGTACGAAGGCATGTGGAATGAAGATAAATTCAGCAACTATGGTACTTACTACTATTCAAATGGAGATAGATATGAAGGTGAATATAAAAAAGGCATGAAAAGCGGTTTCGGTATATATTATTACTCAAATGGAAATATCTATGCAGGCAACTTCGAAGAAAACTAAATGGATGGAGTGGGAAAATTCATCTTCACAGACGGTGAGATCTTTATTGGAAATTTCAAAAAAAATAAAAAAGAAGGTTTTGGAATCAAAAAGTAATCTTATGAATAAGTAGATATGATTTTATCAGGCAAGTGGATCAACGACAATCAAAATGGTTAATTTAAAATAACATTATCTAGCCTAAAAGATGTTACAATGAATGCATTCTTTAAGAAAGGAGAAATTTCAGAAAATGCAAAATATACAGTTAAAATATCTCAAGATAAAGAAGTGAGTTTCAATGCTAAGTGGATTAACAACAGAAGAGTCTAAGGTTTCTAAATTTAAGAAGATCTTAAGAAATAAGAAAGCGAATATTCTCAATACTTGAATAAAATTGAATAGTTTGATAAGGAATATATCAAATTCATTCCTCCTACTATTAAAGTTGAATCTGATGTTAAAAATGCTAATAAAAATGCTTGAAAAATTTTTTATGATAACTATAATTATATTTCTTAATTTAACTTAATTACTCAAATAAATAAATAAAATTGTTTTTCTTTAATTTATTAACTTGTATTTGCTAGTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,002.5 L-23,333.6 L-33,655.4 S-01,215.1 S-32,293.0
S-62,346.9 S-92,805.4 S-122,567.1 S-151,962.3 S-241,908.4
C-03,505.9 C-23,919.8 C-41,572.6 C-6842.7 C-81,698.2
C-102,301.5 C-122,922.9 C-145,004.3 C-165,391.4 C-185,573.4