Summary
Transcript IDgene_000017196
Gene IDTTHERM_00782120
Length1650 bp
Sequence
TCAAAAAAAAATAAACAAAAGTAAAAAAATTGAAAAAAAAAGAAAAACAAATGAAAGATTAACTAATTAAATTAATAGAAGAAGAAGACTTTTTAAATTAAGACATTTACACAAATTATCCTTTTTTAAAGTAGGAAAGATAACACTTTAATTAAATTGCTAAATCTATTTGCTTGAAAAACCAAACTTTTTAACCTGACCTAGAAGACACTTTAGCTTAACAAACAAATTAAATAGATACAACATAACTAAGGATTGGTGGTAAATCCGAACAAAATACAGATTCATTTGCTTTAGAAACTATTACAAAATTCATCTGTGAATAATGGGAAAACTCGTTAAAGTAAAAAATAAACTTAAAAGATAATTCTCATTTTTATGGATTGAAGGACAATGTAATTGAATTAGATTAACCATAATTGGAGGATTTTAAAATAATAACTTTTTTGATACCTGGTAATGGAATTGAGAAAAATAATGCTTCAGAAAATTTTGGATTATTAGAAAATTGTATGGACATAGAATCTTAAAAAAACTTATTTGTTTTTTTCAAATGGTAAGAAGATATCAGCATTTTATAAATCGCATCAAAGCTTTTAAAAACATTTGTGCTTGAATACGAAAATAAAAAAAATTATTAAGAGTATTTAGAAAACTTCTTGAACTATTACCTTGGAAAGTTCTGTCTTAATAAACTTAAGAGGATTGTTTACTAGTTAATATAATAATTAAAAATATGCATCAAATTACCAAAGCTTGCTATTTCTATTCTTAGAAATATAATTGACTTATTTGAAAAAGCACTTGATTCAATCATTAAATATTTTTAAGATACCTACTAACGTTCCATTGATTTTGGTATTGCATTAGCAGAATATTTAAACAACTGGAACTTGATAGGAAATTTATAAATAGATTTCTTGGGATATGACTATGGTACTGTAGTTATAGCTTAGGCATTGAAAAGATTGGTAAATCCAGCTAGATATATAATTCTAATGGGAGGAGTTGCAAAAATAACAGATATAGAATAATCATATAAATTGAAACGTTTTAAAAAGTGTTGTAATTTCTATTCTACTAATGATATTTTCGTTGAAACATTCATTTAAAATACAAATCTTTTAGGAGATTAACTTTTAATAGGAGTAAATTCTATATGTGAAGAAAACAAAGACTTTTTTTCTAATTACGACACAGAAATTGGTTGTTCAGGTTATATAAATAAATATAAAGAGCTTTATGATAAGGCTATGACAACATTTAAAAATGGCTCTTCAAATGAAGGATAAAATAAAAAGAGATAATCTAATAACTATTACTCCAAAATCAAATAATTTTATGATGAGTAGAAGACTTATATTTTAGCATTTGCAGTATCTCTGATAATGAAATGTGGATTTGGTTGGAATAAACCGATAATAATAACGTTATTAGTAACAATTTTTATAAAAATATTTAAAATGACATATAATGCAATAAATGAGAACTACATCAAACTGTGTAATTTTTTAAATATTCGAGTTCCAAATTACCCTTATTGAACAGTTAAAATTTCGAAAAAATAAAAAAAAATAATTGTTATTGTGTACTTTATTTACAATATATTGTAAAATTTAATTAAATCAGTGTTTTTTTAAGACTTCTAGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,410.3 L-21,655.9 L-34,705.5 S-02,981.0 S-33,002.9
S-62,571.9 S-91,958.8 S-121,841.3 S-151,324.3 S-241,186.5
C-03,108.6 C-25,669.7 C-42,417.1 C-62,767.6 C-81,779.8
C-10872.2 C-12383.4 C-14341.5 C-16282.5 C-18203.0