Summary
Transcript IDgene_000017234
Gene IDTTHERM_00624620
Length634 bp
Sequence
AAGTTAAAGATGAATACATAGATAGAGAGTTTCATTGAGAGATAAAGAAAGAATACAATCCCTCAAATGTTTTAGAATAACTAAAGATATTAATATAATTAAGCAGATATAAATAAGTCTAATCCTTTAGGTTTTTTAAAATTATGGAATTAACCAAAAGTTAAAGAGCAGTTGAAATAATCAATTTAGTAGAAGATGTAATAAGGAACAATTCCTAGCGATAAAATAATTAATGAAAAAATGCTTATAACTGAGTATTGGAGTTAATGGCTTGATCTAAATTAAACAGATTTCTTATAGTTGATTTAAAAGAATCCAAGATTAACTGTATAAGACCATCAAGATATATAAAGTTTGATTTTAGATGAAAATGCAAGAATGGGTAATTGGGTGTTAGGTATGAGTATATTTACATATGGTGTTTATTTCTTGGGATTAAAAAAACATGCTATGTTCTACAATCGCTTTTAAAAGAAGAGTCCATATAAAATAGTAAACTACTCTAAAAATGCTTTGGGGTGTTTATTAGTGATGTCAACTTGGTCAATAATATTAAAATTTTTTTTCGAATAAGCTATCCCAAATCAATTATCAAAAAAGGGATTCTTGAGTAAATACCACATTTTAAAGGAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1996.0 L-2991.3 L-3633.7 S-0467.3 S-3245.7
S-6453.9 S-9353.6 S-12247.2 S-15304.9 S-24270.9
C-0301.6 C-2287.3 C-4335.8 C-6190.5 C-8116.9
C-10281.0 C-12243.0 C-14246.0 C-16235.4 C-18201.5