Summary
Transcript IDgene_000017263
Gene IDTTHERM_00695780TTHERM_00695770
Length1058 bp
Sequence
AAAAAATCAAATATTTATCTAATTTTATATAAATAAAATGTCATCAAGTAAAGAGTTTTGTGATAAGTGCGACTCAATCAAAGAAACAGATCCTCAATATGAGACAGCTAAAAAGTTAATGATGCAATAAGGATGCTTTTAAGAAAATAAGAATTTGACAGATTGCCTAAATTTATTTCACAAAGATTGGAGATCTTGCAAAAATGAAACTGACCTCCTTACTAAATGTATATAAAACTCTAAAAAGTAATGAAAAGTTTAACTTGAAATAATCCTCTCGAATAATACCTAAAGTTTCAAAACATATATCTTATTTTAGTGTTAAATTAAACAAAGATAAAATCTAATAGAAATTTCTGTGATTATTTGGTTTTGTTTGAAGAAAAGAGTTACAGCAAACAGAAATGCATATTTTAATTTTATATATTATTAATGTTTAAATAAATGTTCGTTCAAAAATAATTTTATTATAAGACTCATTATTTGTTAGGTGATTTTTTGTTTTTTGGAAACTTTGAGAGCATTTTATAAATAAAAATTTCTCAATGTTAGTATAATTATTACTAATATTTGAAGCTTCAATTAATGATAAATGATTTTAAATATTGTTATGGTTATGATTATATTATGTTTTATATAGTTTTGATATTTATTTTATGTTTTTATATTGCTATTTGTTTATAATTTTTGAAAAATTGCTATGTGAATTTATCATATTGATCACCCTATCGAAAGATATTATTCGCCATTCTATCTAGAATTTGTACTTGTCCTTTCTAAAAACATATCTTCATTTACTGTAATAGGATTTATTTTTTTATTAGATTCAATATCTTTTATTTTGAATTCTTCTCCAACTTCAAAATTATCATCCTCTTCATCATCATCTTCATCGTCATCTTCATCTTCATTATATTCATCATTTTAACCATTTTTTTTAGATAGGAGTTATTTGTTTTAACGCTTCATTTACTTTAAAATCTTGTTTTGTTTCATTTTGATGTAGCACATTAAACCACTTGCTAAAGTAATTAATCCTAAAAGAATGCAGCATGAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,231.6 L-2934.4 L-3715.3 S-0562.4 S-356.6
S-670.5 S-967.6 S-1254.8 S-1559.5 S-2450.9
C-040.6 C-251.9 C-440.6 C-644.6 C-847.6
C-10133.1 C-12149.9 C-1460.2 C-1649.9 C-1840.2