Summary
Transcript IDgene_000017338
Gene IDTTHERM_00628450
Length778 bp
Sequence
TAAAAAGTAGTAGTTTGTTAATTTATTAAAAAGAAGATAGTTTGTTTTTTTTCATTTAAAAACGAATAGAAAGGAGAAAATGGAAAAGTAATTTGACGTTTTGATAAAAAGATTAAATAACCTTGAGACAATTTTAGGAGAAAATTTGAATATTCAAAACGAGCAAAATGGGGGAGAAATTATTAATCCACTTGTAGATAAATTAAATAAGGCAGAAATAAAATTAAAAGATATAATTAGCAATGTCATAAATGGCGCAACATTTGTTTAAGGATAGAATACAGAGATTAGCAAATCAATTCAAAGCATAAATGAGTTTTTAAGAAACAGCGAAATGAAATATGCAACAGCAATTATTGGAAGCAAAAATAGAGCAGATTTGTTATTAAGATAAGAATAAGAAATTCTTTAGGTAATTGAATTATTAGAGTAAATAGAAAAAAATAGAAAAATGATTTCTTTCGATCCCATCCTACAAGTAGAAGAAAAGAAAAAAATGGTAGAAGCTTTTGAGTTTATGAGTGAAATTTCAAGTTAAGGAGGTCCATTAAAAGTAAACAAAACTAGTGACTAAACAATAGCAGAGACTTATATATAGCAAAATGAAGATATAGAACAGCTAATTAAAGATTAGGCAGATATTATAGATACAATTAATAAAAAATTCCTTTATTTTGATGCAGTCTTGACTCAATTAGAAAACAAAAAATGAATTTAAATTTTATATCTCATTGTTTAGTGTTTATTTGATAAATAAAAACTATTTTAATTATTTCTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,820.7 L-21,601.2 L-31,511.3 S-01,937.6 S-3869.2
S-61,229.2 S-9795.0 S-12571.8 S-15629.0 S-24535.9
C-0395.1 C-2474.7 C-4721.9 C-61,770.9 C-8678.5
C-10789.4 C-12603.3 C-14366.3 C-16370.0 C-18256.6