Summary
Transcript IDgene_000017398
Gene IDTTHERM_00463160
Length153 bp
Sequence
CCGCTCAATATTCTTGGATTGTTCCACAGGAATATTGCTGGATTGCAGAATAAAACTTGAATGATTAAAATTCAGAGGTATTTGTACCTGCTTAGATTTTAGGTTTTAACAAAATTACAAGAATGGCTACTTGTTAGTTAAGCAGTGGTGGCG