Summary
Transcript IDgene_000017399
Gene IDTTHERM_00463160
Length186 bp
Sequence
AGCTCGTATAACCAACTAGGGATAGGGAGAGAGAAGCTTCCACATATTTTATCACTTTTTAAAGGGTGCTGATAAAGAGTGTTTGCAGAGATATGGACTTGAGTATCCTGTTTCTTTTGAAAAGTATGCATATTTATCATAGTCAAAGTGCTACGCTGTTGATAAAATAGACGACATCAAACTGTT