Summary
Transcript IDgene_000017548
Gene IDTTHERM_00052350
Length1420 bp
Sequence
GTAAGCAGAGGCTAAGCACTATGAGCACTTTAACAAAATATTAAGATGATGATTAAAACTCTAATACAGATATAGAATTAGAAATAGATGAACCTAAAAAGCGTTTATATGTTTACATATAGCCTAATGATATTTTAAGTCTTTGGGCAATAGTTGAGGATTAGCTTAAAAGTATAAAAGCAAAACACCATACTATGAACGAAATTGTGGGGATGATATAAAAAATTATTAATGCTCATTTCACAAATAAGAAGAATATTTCAACACAAATTCTTTCAGAATATTTAGATGAGCTTTCAATGAAGAAACAGCAATTATATTAAAATGAATTAATTCCATATATGGCTAAATTAGCTCTAGATATTAGTAATGCTTTTTAGTAAGAACCAATAAAATTGCTTCTTTAAGGAGAGAAGGAGGAATAAAAATTTACTAAATACTAAATAGCTGTGCTTCTAAGCAATATGTTTTTTTGTACTCTACATAAATAGCCTGATTTAGATAATTTTCCACTTTGCTTTGATTTTAGTAAATTATACATGAAAGGGACTGATGCCTCACTAAACAATTTAAAAAAGGAAAAACTAAAATTCCTATTTAACTATTTTGAGCAAGTTTATAATGATAAAATTAATTTAGATCTTTGTGTGTCATTTGAAAGAGTAAATTATAGCTATGGATAACAAGCTTCTATTAATGATTTAAAAAAGAGTAATATTACAAAAAAATCTTTAGTGGAAGTATATTCAGATAAGAGTATAGAATCAGGAAGGAATTTAATTTAAGTTACTTTTGCTAATAAGTTAATTGGAGGAGGGGTATTAAACAGAGGAGCTTTGCAAGAAGAAATTAGATATCTTATTTCACCTGAATGTTTAGTTGGAATTCTATTATTTTCTGAGCTTTAAGATAATGAGGCTATTGTAATTTAGGGAGCTTAGCAAGTTTCTGACTATGAAGGTTATGGATGCAATCTTACATTTAAAGGCCCATATTATGATGATTAATTAGAAGTTTAGGAAGAAAACAATATGTTAAATGTAGTTATAGTAGGAATGGATGCTATAGATTTTAGTAAAGTTGAAATAGAAAATGAAAAATACGAACATAATTATTAGTTCGAATAAAATAACGTTATGAGAGATATTGCTAAAGCTTATACTGCTTTTAGGTGTGATAACGTCTTAAAATATAATAACCGTAGATAAGGAATAATTACAGGTAATTGGGGTTGTGGTGATTTTAAAGGAGACAAGGAGTTAAAATTTCTAATTTAATGGATAGCCGCCTCTTGGTGTAAAAGAGAACTTTACTATTGCACACATAATGATTAATTATTGAAAGCAAAAATAGAAGAAATATATTAATATCTTAAAAGCACTGAGTACACTTTATATTAGATACTTTAATTTATTGGCAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,240.3 L-21,264.6 L-31,343.8 S-0717.6 S-3831.2
S-61,061.1 S-9984.4 S-121,037.3 S-151,067.0 S-241,070.5
C-01,123.3 C-21,929.6 C-4838.5 C-6797.6 C-8564.3
C-101,423.7 C-121,437.0 C-141,935.6 C-161,822.1 C-181,413.4