Summary
Transcript IDgene_000017711
Gene IDTTHERM_00037190
Length5113 bp
Sequence
AATTAGCAAATTTAAAATAATTAATCATCTCAATAATAAATTAATGCAGATAAAATAGAGCAATCTAATGAAAATTAAAATAGCATAATAAACAACTAGGCTTAAATTAATGAATAAAATAAAATCACCTCAACACCTCTTTCTTAAGGAAGAACTGCTTCTTAAAGCATCTAGCTAAGAAGTGAAATATAAAATGATATAAATCTTCTTAAGAGCAGCATTGAGACCAATCAAAAGAAACTCAACTCTAGCTTCTTACATAATTTTAACAATGGAGAAAATAGCAATCCATATAGGGCTACCTAAATGTCTAGCCAAAAGGAAGCAGTATTTGAAAATGAAGATCTTGACATTATCTAAGAAATAAAAAAAGAAATTAATGAAACCTAAGATTTATCAAATTCTGTAGCAAATTTAAAAGATAACCTTATCACATAAATAAGTTAATAGCAACAATTCCTTACAAATTTTGTTGATAAGCAAAAAAATGCTATATAAAACTTAAGGTAAAAGTAAGGTATCCTATTTGAATTTATTGTGAATCTCAATTAAGATACAGAGAATTTAATTTAATAGTAATAATAACAACTTACTTCTTTCTAAGAAGATTTCAATAAGTAAAATAACATCTAGCAAGAACTCATTATGAATGAAATTAATGCTTAAGATAATAAATTTAAAAATCATTTATAATCTTTAGAGAATCTCGCAAATAGAGTTTAATACTCTTAAGAGGCAAAATAAAGTGAAATTCAGTAATAGCAACAAGCTATGCAAGAGGCTTCTCGTCTTCTCTTGGATTGCTCCTAAGCTCTGCTCTACAGAAATCCACTTTCAATATCTTAAATTAGAGAAAGTATTTATTAGTAGTCTTTCTTGAATAAGTCTGTTTCTTAAATTAATGACTAAACTCCAAGTCAAGTTTTTAACATGCCATCTTAAATTAATCAAGGTTATCAAGGTATTTAGAGCAATTTAAAGCAGAATACCAAAAATTGTAACTCTGATAATGAGTAAAGTGATAAGGAAAGAATAAATAGTTCTCAAGATAAAAATTTAAAGTCGTAAAAAGATTCTCTTTCATCTTCATTCCAAAGTCAAAAGAACTAAGTTCAAGGCATTCAAGAAAATAATTGTTAATAAAAAAACTCACAAAATAATTCAGAATAAAACAGAATCATATAAAATGCCAATTTGTTAGAACAGCATAACATAGTTTAAAATTAAAGCTAAAAAAATTAAAATCTTAATTCTATACTAGAGCATGATAGAATATAAATAAACTCTTAAAATTAAAGTGAGTAAGCAGAAATAAAGCAAATATAAATTAGTTCATAGAAAGATGATAATAATAAAAGACAAGAGTTATTCAATTCAACAAATACATTAAATACTTAAAAATTTACACAGGAAGCATAAAAGCTAGAGGGATAAGACGTCGAAAAAACTTAGATATAGCAAAATTAGCTTATAAATTAATAACATCAAACTAATATTTAACAAGATTAAAATAAAATAAATTTAAATTCTGACTAAGAAAACAAAATGTAAGAATTAAATAATTATATTTAAAATATGAACACTCCAAATTGTGATACAATAGAAAATAAATAGAAGAATTAAAAAATTTATATTGAGAAATCACCATCATAAAACTAAATAAATGATTTAGCTAAATAGTAACAAAAAGCTCCAGTAAGTAAAAAATAAAAATAATAAGAGAAAAAGAAGGCTGAATAAATATAAAAACAATTCCCATAAGCATAAAACAAATTCATAAATTCAGTTTAATAAGATTAGAACAAAAAAAATACTTAATAAGATTTAAAAGCTTAATAAAACTAACAATTTCAGTAAAGAGAAAATGAATAATAATAAAAGCCTAAATCTGATAATGAATATGAAACAAAAATAAGTTATGATTCTTCCAAAACTCTTTTTATAGATAATAAAAATAATGCCAATTTAAATTAAAGTTAAATATAATCCTCAGACATTAGTGGTTAAATAAATACAGTATTGACAAAGCCTTCGACTTCTGAACTAAGTATTTCAAATATAAAATCAACAGAAAATTTGGCAGGAGATAATATTTCTTCTACAAAAATGAAGAAAAAATTGCTTCTCAAGTAAAAAATAAATTAAAATTTTGAACCTTTCCTACCTAATGAACAAATACTATAGGAATTATAAAACCAAAGAGAAAGAGCATAATTTGGTTATTCAAATTCAAATATTGAAATACAAAATCAAGGGGAAAGTACAGGATCATCAGGTGATAAATAAAAGGATAACTTCGATAGAAACGAAACAGTAAGATAACCAATTGGCTTTAATGAATATGTTAAGGAGAATCAAAATTCACAGAGACCAATGCCATAAAATAAAAATAATTTGTATAATTTATCAGAAAATAAAAGTTTAATAGAAGAAATATAAATCAGTCAAAATTAAAAGTAGGCATATTAAACTAAAAATTTATCTTAATTCATTGAAGAGTAGCAAAGAAAAAGAAAAGAATCAATTAAAGATCTTCAAGAGAGTTTCTAAAGCAGCAATAACTCAAGCTAAATTATAAAATCTGATAATTTAATCCTTCAAAGCGAACTTTTTGAGTAGCCAAAAAAGAGCATTTTTGAAGGCAATAGCTTCATGTTAGCTATTTATTAATAGACTTTAGAGGCTGAGAGAAGAGTAGATCAAAATAAGAATAATTCTAAATAAGCTTCAGCTTATAGTGAATCCAAAAAAATAGCATAAGTATAAGAAATAAAGTAAAAATTGGATAAGATTGAGAATTCATAAAAGAAAATCAGGAAATAGCAATCTTAAACAGATCATGAAGAGTATAAGAAAAGTGTGGCTTCAAGTAAAGAAGATGAAACTAATACCTAATACTAACTTATTAAGAATTTCACAGAAGAAAACGTGAACATAAATGAAGAAAATATTTTTCAAAACTAACTGATATAAAATGATAAATAGTTCATGAGATAAAATATTAAAGATAAAAAATAAGAAGAAGAAAATGAGTTTGAAAAATTTGAAGACAACAGTAATATAAGTCAAAGAGAACTAAATGAAGATGATGACTAGAATGAAGATTTTGATGAAGAATAGTAGGAGCTATCAAACTAATATAAAGAAGAAAGAAGCTAGAGTAATCATAGTGACGAAGTTGAAGACAATTACTCTGGTATCAAAGAGGCAGAATCAGAATAGTAAGTCATTTGCCCTCAAGACAAGGAACAAATCAACTGAGAGGAGTTTTTCATCTAACAAAAATCACATACAAAATAGTATTACTAACACTTCTAATTAGAGCTAGCACCACTCTTATATGCGTCACAATAATTATAAAGAAAATCAAATCTAAAACAATAATAAAAATTCTAAACAATAAATGAGATCATAAAGCAGTTAGGAACATTACTGGAGAGCTCCCCATGTCGAATATATTGATAAAAGATAGCTTACTAATCAATTCAATCTAGAGAGAAAAATGTCAGATAATTGTAGCTCATCTATTTTAGCTTTAAATTCGGAGTCTTCATAGGCAGCAGTTTAATAAGTACACAAAGTTCAAACTAATTAGTTTCCATACTCAAATGACAGAATCGATGAGGAAGAAAAGCTCAATTCAAGTATTATAAGCAGATAAACAGAAGTAGAATACAATAATATTTATGATTTAATTAAGCCAAGGAATAGAATGTCCCAAAAAGAACTATCTCAAGCTTTAAAGAAAAATACAGAAGAGGTACAGCAAAGGTTGAATAAATGGAAGGAGTAAGAAGAATTATTATACTCATTCAATACATAGAATTTATAAAACACAACTGATATTATTTCAAGCGAAGCTAAAAAGAAAAAACTAACGAAATCGACAGTCTAGATGTTGATTGTTTTAAATTTTTAGCTAAATTAATATAAAACAGAAATTATTGAAATAAGTTCATTTGTAGTGAATACAGATAGATATCAAACAATAGATGAATTCAGCTCCTTTGTAAAACCTAATGATATGAGAATAAGATTTGATAAAGATAGCAATAAATAGAATGTATTATAATCATTAAAAATGTCGCAATCATTTGAGGTAGTATTTGCTAAATTATGCAACTTTTTCAAACCTTATCTAGATAACTATAAATGTTGCATTCTCTATGACTAACAAGAACACACAGAAATCCTTTACAACGAATTCATAAACAAAAAAATTATTCCTAGTCCAAGTGTGCTAGAAGTATTTTATACATGTATTTTCTTAGCTGACATATTTCCTCTATCCCTTAATACGAAAAGCACACCAGTAAAAAATTATCATGAAGCTATGATGCTTCTCAAACTAAAGAAATACTTAACAAAGAAAAATAAAACAATTGATGTAAAGAATTTTGAAAAAGTTGTAACAACTCTTTTATCTAAAGGAGTAGTGATTAGCTCCAAGGATGTTAAATGTGCTTTCAGTCTAGATTAGAGAGAGAAAAAAGTTTAACAATTCATAACACTATGCATGGAGAGTTTTGAGCAAAACTAGTACTTTTTTATTTTAGAATTTTAACATGGAAAATATGACACTTATAACTAACTTGAGAATAGTGCAATAAATATTTAAATCTTATAGAAGACAACAGGTTTTTCTTTTTTACACATTCAAGGAATGTATGGATTTAGTTATGATTTCTACCGAAATGACATCTCAGCTTTCCATTTCTACTTTATAAGTTACCTAAACGCTTTGAAAATAAATCAAAATCAATTGACTTTATTTGTTTTAGAAGAAGACAATATACTTGCAAGTCAGGCGATTGATCTTATGTTCCCATTGAAAAAAAAGCCATAAAAAATTGTTTTATTTAAAGAAGTATAAGCTTAAATATGGTATAATTTAGAGCATATTTTGTAGAAGAATATGTTTAGCTTTGATTTTGAGCATTTATTTTCTACATTGTGTGGTCAAAGCTAGCTTAATAATTAAAATTTATTTTAAATGTGAAAATCAAAAATACATAATAATTAAAACTAATTAATAAAGTGTACTGTAATAAAAAAAAATATATATATTTATTTTACATTTATTTTCAATTTATTTCTTTATAATCACTTTAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1289.4 L-2229.5 L-3231.8 S-0139.5 S-3415.2
S-6309.6 S-9286.9 S-12273.4 S-15290.8 S-24305.3
C-0468.3 C-22,655.5 C-41,431.3 C-6778.2 C-8999.0
C-10910.6 C-12541.5 C-14528.0 C-16495.1 C-18524.1