Summary
Transcript IDgene_000017881
Gene IDTTHERM_00161490TTHERM_00161480
Length1046 bp
Sequence
AAAAAATTAAAAATCTAAATTTCTCATTATCAATAAAAAAAGATTAAAAGTAAAAGAAAATAGAGATGTGCAAACATATTTTAAACGTTTAAGTCGCAATTAGAGCCCCATGCTGTAAAAAGTGGTTTGACTGTGCTGAATGCCACAATGAAACTCAAGATCATGAATTAAAAAAGGCTTTAGAAATGGTTTTTGCTTGCAAAGTTTGCAAAAAAGTCTTTAGAAAAGATTTGAAGGACTTCGATGAATGCGATGAATATTGCCCTCATTGTGATAATAAATATATTCTCGATGCAGTTACTAAGGAAGATAAAGATTCTTGAGCAAGCAAATATGAAGCATACTAAATAATAATTAATTTAAATTATATACAAACAAAGTTAATTAATTACTCTAAAAAAATTTTAAAGGCAACTAATAAAATATAAAATATTCATTTTCTTCTGAAAAAACTAGGAATATTTATTTATTTATTTGAAATGAGAAGTAGATAAAAAGTAAGTAAATAAACACTTTAGTTAAAACGAAATAAATGCAGACAATTTAGCTAATTATTTAGGTAGAAATAAACAAAAATAAAATAATTATATGCTTAAAACAAAAAATATGTCAGAAATAATAACAATCTTTATACTTAACCACAAAAATGAATCAGAGTATAATTAATTATTAATTATAAATTCAAATCTTAACTACAAAAATATAAAATATCTCTCTAAATTTCTTGATATATTTAATTTAAAACATGCATTAAAGTGTATTTTTCTTTTATATATTTGTATTATTTTTCCTAGACTGCAGCAAGGTATTCATTCGCTCATTAATTCATTCTTTTATACAATCGTTTCATAAAATTTATTAAATATATAACTTTTATTTAATTGTTCCTATGATAATTTGTATTTAAAGATTAAATAGTTTTCTAGCTGGAAAAATTAAAATCCAACTATGAGTAAATCTTGTTTTTCTATTTGGATCATTCATTTATTTTTGTTAACATTTTAAGGTTAAGAAACATAGTTAGGATTGACTTGGACATCTGCTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,437.8 L-24,809.7 L-32,915.6 S-01,925.1 S-32,423.8
S-62,310.0 S-92,339.9 S-122,698.7 S-152,914.7 S-242,731.8
C-01,859.3 C-2949.4 C-42,230.5 C-64,519.0 C-84,076.5
C-101,494.6 C-122,159.3 C-141,442.0 C-161,735.4 C-181,488.6