Summary
Transcript IDgene_000018273
Gene IDTTHERM_00083650
Length840 bp
Sequence
GTAAAAGGTTATTTGTGAAAGATTTATTTATGAGTTTGAATAAGGAACATTAGGAAATTTGTTTTAAGCTATTAATTATAGGTAACTCAACAGTTGGAAAGACATGTCTATTGCTGAGATATTGCAATAATAAATTTTCATATAGCCACATACTCACAGTAGGGGTAGATTTTTAAATAAAAAGACTTGAAATGAATGGAAAGAAGCTTAAACTGTCTATTTGGGATACAGCTGGTTAGGAAAAATGGAGAACTATTACTACAAATTATTACAAAGGATCTGATGGTATTGTTGTAGCATATTCAGTAGAAGATTAAGAATCTTTTGACAAAGTAGGAAGCTGGATTGAAAGTATAAAAGAAAATTGCGATAATGTTAATATATCTATTTTATTAGTTGGAAATAAATCAGATTCAAAACAAAGAGTAGTTACATATGAATAGGGTAAAAAGCTTGCTGAGTAATATAATATTCCTTTTTAGGAAACTAGTGCTCTTGATAATATTAATGTGACCGAATCTTTTAATTAACTTGCTAAAATGTGCTTAGATTAGCATGAAATAATAAGCTCTAAAAAAAAGAACCAGAAATCTTCATCAAACGATATTGATGAGCAAATAACTGGCCCTTCTTAATCTAAAAAGTTAACTTCAAAGAAAAAAGATGAAAACGGAGAAAGTAAAAAAAATTGTTGTTGAAAAGTCTAGCTTTTTAAACTGAAACTTTCACACCTATTCAACTATTTACCCATCAATCTATCTTCTATATTTTAACAAAGCATATAAACAAATAAATAAATCTAAAAATCAATTTAATATAAAAAATTGTTAATTACCACAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1777.3 L-2769.6 L-31,185.1 S-0408.5 S-31,176.2
S-61,946.9 S-91,826.0 S-121,006.5 S-15917.4 S-24601.2
C-0615.0 C-2782.6 C-4453.1 C-6225.5 C-8448.4
C-10443.3 C-12497.6 C-141,095.7 C-161,337.7 C-182,064.7