Summary
Transcript IDgene_000018285
Gene IDTTHERM_00082150
Length535 bp
Sequence
TAATAAATACAAACAAAATAATTTATAAAATTTTTCAAAAACATTTAAACTTTAAAAAAAGTAATTCGTAAATAGCAACAATGTTAAAAGGAATCTTCGAAGCTCTTGCAGGCAACTTAGTTATAATTTGGGTTATGTTTATTTTATGCCCAGTTTATCTTGTTTTAGGAAATTTAATCGCAAATTTCTATAAAAATATCTGGTTAATGGTAACTAGTAGATAGTCATGGGTTTATAAAAATTTAGGAGATCTTTCATGGCTCTTCCCCTTCACTTAAAGTAGCTAACAAATTAGATTAACTGATACTCTCTTAATTTCAGTTTTATGTGGTATTTTATCTCTTCTGATTGTAGTTGCTATGGTTTATAATAATATGCAAGAAAAAAACCAAAAAAGACTTGAAAAAGAAATCAAAGAAGAAATGGATAAAAAGAAAAATTGAAAACTTTAATATTATTTGTCAATATAAAATTTTTAATTTGTATTTTCATTAAAAGTATTCCTTTAAAGATAATCTTTTAAAATCATCAAAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,855.6 L-21,753.2 L-31,762.8 S-0973.8 S-3801.1
S-61,038.3 S-9710.0 S-12757.7 S-15781.8 S-24666.6
C-0799.6 C-2547.6 C-41,260.4 C-6559.0 C-8362.2
C-10883.1 C-12795.1 C-14660.9 C-16679.8 C-18570.6