Summary
Transcript IDgene_000018395
Gene IDTTHERM_00383490
Length402 bp
Sequence
GAAATTATTCAATTAATTAATAACAGCAACAATCAATCAACCAGCAATAAGAATAATAAATAATAAATATATAAAAATAGGTTTAGGAGTTAATTATTTGTATTTATTAGCTTTCTCCCATGAATTATCAGTATTTGCCTCAGCCTAGCCAAAAGTTAAATAGTGGATAAATTAAATAGTTTCAAAATAGCCAACCTGTAGGAAGCAATCACTAAAATAGCTATATTTAGGATTTAAATTAATGCAAAGAACATCCAAATGAGTTAATAACTAATTTTTGCAGCTGCTTAGAGTGCTTAAAGCCTCTTTGTCCAGAATGTGTGACTATCCATAACCAACAGCATAAATAGCAAAGAACATATGCAGAAATCGAAACCATTCGTAGCGTTAAATAAAGATGCG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1353.8 L-2371.4 L-3228.8 S-0119.7 S-3189.6
S-6139.0 S-9311.8 S-12254.9 S-15415.9 S-24304.6
C-0128.0 C-2113.1 C-4116.0 C-6136.5 C-8506.5
C-10491.7 C-121,288.7 C-14759.4 C-16388.5 C-18528.0