Summary
Transcript IDgene_000018396
Gene IDTTHERM_00383490
Length1967 bp
Sequence
AAATGCTAAGACGTTATAGGAAAAGAATAGATGATGTGATTGATACACATTTTAAGACAATAGAAGAATAAATAGTACAAAATATGAAAGAGTTAAAAACAAGAATAACAAATTTCGAGCCTACGTTTGCTAAAATGAAGCAAGTCATTACAGAGTTTTAGAGTTTATGTTAGCTTTTAAATTCAAATGATTATGTTGATATTGTTCAAAAAATATGTTAAATGGATGTATAGCATATTATAGCAAAGCACAAAGGAGAGATAAATAAAATAGCCTCTTCATTAAGTTATGAGTGCTTACTCCCAAAATTGGATGACGCTCGCGTTTATTATCTCGTTGAGGAGTTAGAGAGAGTTGTATCTGTTAGAGTTGCTGATGTGTAAGATTAGCTTTAGATGAATTAATTTGCATAGAACAGTACATAGAAATCTCCTTAAAAATACTCTCCATAGTAAAATATATCTATGAAGTAGTCCAACACAAATTATAATCCTTAGCAATAGCAAATTTATTAAAATAATAACATAAGTATAAACCATTCAAAATCAGGTTAGCAATTTTAAAGTATTCAAAATGATAACGAGTCTTAAAGATAATTTGTTTCAGCCAATTAATCGTAGCAGTAAAAGTACCAACAACAACAACAACTTTAAAATTAAATGATTTAGAATGAAATTTTTCAAATAACTGCTAACGATTACTTTGATAAGAAGTCTCTGAGAAAGTTCTTGCATTTCTTTTAGAACGATGACAATAAATTACATTATATAGATTTAACTGAGTTAGATAATTATGATTTAAAGGAAACGGCAAAATCGAGTAATCCTAGCAATTTATCTAGTAAAAGAGTGGCAGGGATTGATCAAATTTATAACATTGTAACAATTGATCTTAAAATATCATTTAGAATACCTTCATTCCACAAATCTATAGCTACTCCTATTGGAGAGCTATTTCTTACAGGAGGAACTATACCTGATGGTCAAATGAATAAGAGTGGCTGGATTTACCAATATGATTGGTAAAATTAGAGTCTCATATAGCTTTCCAGCATGAATCATCCTCGTAGTTCACATGGTATAGCATATTTAGCAGGTAAAATTTATGTCGTAGGAGGTTACGAACACAAACATGTTATGACTAAAAGATGTGAAAGATTTAATCTATTGACTAAAAAGTGGGAAATGATATCTAATTTGAACTACGCTGCAACATCTTTGTCCTTGTGCAGCTTCAATGGAAGGTATCTCTTCAAATTTGGAGGAATAGGAGAAGGATATGACAATCATCTCCTTAGTCCATATATAGAAAGGTATGATCAATTAACAGATTCTTGGGAGGTGATTGATCCTAAGCTAAGTTAAGTTCATAAATTGAATAAGATAGGATTCAACTTTGGTCTGCTAAGTACATCTGCCTCAATATAAATAAACAAAACAGATATATTTGTTTTTGGTGGTTATCACGAAGATAATTCTGGATCAAACTAATCCTTTATTTTATAAGTTATTGATGAAGATTAAAATTAGAATGATGAAGAAGAAAAAGGTTACGATGATTAACAACATTAATACGATTACTAGGGATAGAATTAAATGTATAAAAACGAGGTTTCTTCTTAGTATTTTATAAAAAACATTAATTCTAAGCTTCTCCCTAATTCAGAAGCATTTTGGAATAACGTGCCAATAATCTTTAACAAAAAGGTGTATGCTCTTTAAAACATAGCAGGAGAAAATTCAGATAATTGCCTTGAAAATGAAAGAAAAATATTAGCTTTTAATGAACGTGAATGGAAAGCTCTAAATTGAGAGAATGTAAATTTGGTGTTTTTGACTGAAATAAATCCAGAAATTAAAAACCCAAACCAAAGAAAGAAGTTTTTTAAATTTCTGAATAAAATTTATTAAAAAACAATTAAATTTTGAATAAACTACAAAAAAATGCATCTATCTATCTATATGCGC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1529.8 L-2388.1 L-3342.4 S-0210.1 S-3258.0
S-6291.2 S-9415.8 S-12366.1 S-15391.3 S-24477.3
C-0336.0 C-2155.0 C-4189.4 C-6208.7 C-81,325.4
C-101,224.1 C-121,596.8 C-141,488.3 C-16789.5 C-18685.7