Summary
Transcript IDgene_000018524
Gene IDTTHERM_01544790
Length241 bp
Sequence
GTAAATATCAAACAATTTTGCTTAAAAAGGGATTTTGGAGAGAAAACTCAACTTCTTCAAATATTTTGGCTTGTAATTAAAACAAAAATAGTTGCATTGAAAGTTAAGCAGGAGTAAATTTAGTCAATACAAACTAACAGTGTGCTGAAGGGTACATTGGACCTATTTGCGATGATTGTGATATAGAAAATCAATATTGGGGTTAAAGATATTAAAAAATAGGAAATAATCAGTGTGTTAG