Summary
Transcript IDgene_000018644
Gene IDTTHERM_00490750
Length2449 bp
Sequence
TAAAATTAGAATGAGTGACGATATAAATAATAAATTGGTTAACTATTTAATTCATAAACCAAAAGATTAAGTTATAGATAAGTTTGAAGAATATTTTAGCTTTCTCAATAATGACGAGCCTTCATGGATTTTATACGAAGGTATTTTATATCCTTCAGTAAGTGTAGCATTTTAAGGGGCAAGAGCTTAGGATTTTGAGATAAAGTAGAAAATAGCAGATGTAGATTCTCCTGATGATCTCATATTACTAGCTTCTGAAATCGAAGATCCTCCTGATTGGGAGAATAGAAGATTAAAAGTCATGGAAATTCTAATTAGAGATAAATTTCGTCGTTCTCTTGAATTGAGAGAGAGATTAAGACTAACTGAAGAAAAGTAGCTAGTTTGCAGATTTTTCGAAGAATCACCTAGTAATTTGTTTTGGGGTATAGTTGGAAGCAAAGGATAAAATTAGATAGGAAGAATTTTAGAAAAGGTTAGAGGAGATATTCATTAAAATGTTGATTTGAAAAAGTGGATGTAAACTAAATTTCCTTTGCAATAGGACAAGATTTTGTTACCAGTAATCACTTTGAATGTTTCAAAAGATGGAGAATAGATTGAAACTATAACATTAAAAGAAAGAAGTTATTATTATATGGGCTAATATAAAACAAATAGCGTTATCCTGGCTCATCCAAGTATTTCTCGTTTACACGCTTGTTTGATCTGTGAGGAAGGTAATAAAGTTAGACTTGTTGATATGGAATCTAAATCAGGTTCTTTTGTTAATGGGGAGATATTAGAGAAGCTTTTTGATAAAGAATTGCAGACAGGAGATATTTTGACTTTTGCTTTATCTACTCGCTCTTATGAGATTAATATTGATTATACTGCAGCTAAGTAAGAGTTGCAAAAAAGAAGCATTCAATTACAACAGTAAGTTAAGCAACTTTAGAAATTGAACTAACCTTCGATTACTCCTGAAGAACTTCGTAGAATTATGGGATTTGATATTGATAATACTTTATTTATCAGTGGATTACCTGATAATGCTACTGTTTTAGGTATTAGAGAAATGTTTGAGAGAATAAGTGAACCTAAAAACAAGGATGAAAATGAAAAGAAAAAATTTTAAGGAATTAAAATCAAAGTTTAAGAAGTAAAAATTCCTGTTGACAAGTGGTCAGGAAGACCAAAAGGCTTTGCTTATGTTACATTTTAGACCAGGGAAGATTTTAATAATGCACAATTGTACTCCTTTGGTTTGAAGTATGGGGAAGTAAAGCTTAAAGTTAAGGTGGCAGATAAGGATAAATCTGCTTAATTAATGAATATTTGCAAGATTAAAGATGGAAATAATAACGATGAAGACTCTAAAAAAAGATACGATGATAAAAGAGGCAGTGAAAGAAGTAGAAGAGAAAGAAGTTCTGATAGACATAGGGATAGAAGCTCTGAGAGATATAGAGATAGAGACTCAAAATATAAAAGAAGATACAGCAAATCTAGATCAAGATCAAACGATAGAAAACTTAGAGATAAGAATAGAGTTAGTAAGTTTGATAATAATAACCAAGACAAAGAACAAAAAAGAGAAAGAGAAGAGGTTAAAAATGAATAGAATTAGGATTTGGAAAAAAAGCAAAATAGTGAAGACGCTTAGAAAAAAGAAGAAAAAGAGCCATCAAGCAAAGTTAAGGAAAACAAAGATAAAAGAAAAAGAAGCGACAGTAGAGATAATAACAAAAAGTAAGACAAAAGAAGAGATAGATCTGAGTCAAAGAGCAAAAATTAAAAATCATCTTCTCGTCATGAAAAACACAAGAGAAGAAGTTAATCTCCTAAATAAAAGAGAGGTAGCTCTTAAACAAAAAATGAATCAAAAAAATCTACTAAACATTCTAGAAGCAGATCAAGAGAAAGAGAAAGAGATAGGGAAAGAGATAGAGATAGAAAAGATAACAGAAAGAGTAATAAAGATAGCAGAAAATCAACTTCAAGAGATAAAAAATAACATAGAAAGAGCTCATCTAAAGATAGAAAAAAACAAGATGAATAAAATAATAAGTCAAACAAAGCCTCAGAGTTACCAAAGAAAAGTGATAAATAAGCTGATAAAGATTCAAAGGCTAAAACTGATAAACAATTAGCAGAAAAACAAAGCGAAAACTAAGTCAGTAAAAGAGAAGAGAAAGAAACAAACCAAAAAGCTAAATAAACTAAAGAAAAAAAGAGAAAAGAAAGTGTATCTTCAAATTCATCTTCATCTTAATCTTCAAGATCTTCATCTTCTTCAAATTCATCTAATTCAAGATCATCTTCTTTTTCTTCTTCTTCATCTTCTCAAAGCAGTAGTTGAGCTTTATTCCCTATTAAAATTAAGTTTATTTTTAAAATTATCACATTTCAAATCTAATAAATATATAATAAAACAAGCAAGTACCTTTAATTTCTTGTCAAATTTAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,380.4 L-23,143.3 L-31,979.1 S-0946.6 S-31,150.7
S-61,087.4 S-91,153.8 S-121,644.9 S-151,731.8 S-242,304.1
C-02,869.8 C-21,165.3 C-41,868.3 C-64,120.2 C-82,180.6
C-101,832.6 C-121,034.9 C-141,525.7 C-161,552.8 C-181,342.6