Summary
Transcript IDgene_000018807
Gene IDTTHERM_00633390
Length353 bp
Sequence
TCAATATATACTGGATATTAGGATATTAATTACATTTAGATATATAAAACATTACCTAATAGCATACTTAATCCATGGCGAATGAAGTCGAGATAAAATAGTGGTTGAATAGCGACCTAAGAATTGAAAATAAAATTAAAAATTTAGAAGATGATATGCGTAATGGATATATTTACAGAGATATCTTAATGAGATTAGGTTTAAATGTGCCATCGACAATTGTCAACAAGACTGATGATGCTACAATCAAGTAAAATTATTAAATAATAGCAGGAATTTTAAGGGAAAAACTAAAGATAACTTTAATGCCAAAGCCTGGAAATAATCTTGAAGTCCTTAAATAATTAAATAAG