Summary
Transcript IDgene_000018824
Gene IDTTHERM_00637050
Length2482 bp
Sequence
AAATTTTTTTTTCAATTGTTTAGCTATATATAAATAATTAAATTGTATCTGCTAAATTTTATATTCATTCGTGCATAAAATGAACAGCAATCGATATTATAAAGAAGAAAAATCTAAAAGTAGGAAGTAAGGACCAAGAGTGTACACTTACTAGAATAAAGATATATCTTCAATTCAACAATAAATTGTGGTGGACCTCTCTTAGTCTTCTTATAGTTAACCTTAGACCTTATATGATGATGACTCTATTTACACGTTTTGCTAATCTTAGAATAAAAAGCAAGCTAAGCATTTCTCTACATAGTCTGTTTCAATTTCAGTTGAAAACAGCTTAGACAACAATCTTTAATTAAAAGGATACTAAAATAGTTTTTAGTCCTCAGTAAGCATAAAAGTTTCTTCTTCCAATAATTAGCCTAAACCCAATAAAAACAAAGGTAAATAGGAAAACAAAAAAAATAATAATCTTAAAAAGTGTACTTCTCTTAAGTCTATTGTTGATCCCCTTAGTGAACAGTAGGATAAAAGCGCCTCCATTTCTTCCATATCTTTTTCAAACTCAATAAAATTTGAACCTAATAGAAACAAGTTTTAGTCATCTGTTGATAGTATTGATTCCTCTAATAAGCGTTTAACTAGATCTGCTTCTTAAAATTAGAATTAAATTATCTTCAATAATATTTTTAGTGGCATGCAACATATTAAAGACAAAATGATTCAATAAAATATTTCCAGTAACACTTCCTCAAGGATGGCAAAAAAAAATATTACAAAGGCAGTCGGAGTGTAGAACTTGAATAAAAGTTAGAATAGTATATTGAACTGTAGTACAATTACTGATAGCGATATATGCTAAATAGAAAAGACTAAATATAAGAAGAAAGGCTATAATAATTCCTAAGAAAGTAGTGTTGAAGCTTCTAAAACTAACTTTTTAGTTGGGGCAGCAAGCACAACTCAGCCTAAGTAACGTAAAAATGAAAAAAATTATTCTTAAGAAAATGAACTTGATGATGATGAAGAAGATGATGAATTATATTATCTAAGGTAAACAGCTAAAGCATATGATAATAGAAAAGCTAATGAGAATAGATTTGTATTTGCTGATGAAAAGGATTACAAAAATCTTCAGAATTAAAAGATGTTTGATGAAAATTCAAAACCATCTTTCAAAATAGTAAAAAAATCAAATAATATTTTCAACGATAAAGCATGTCTTAAAAATGAGACAAAAGATAGCTCATACATTAATTAAGGAACTAGAAAAGCCGATTCTGCTTAAACAAGTGTAACTTAATGCAAAGAATAGTTAGAGAGGAATTAGTAATCTAAGCTCTTTGAAAAACATTAGAATGGAACAAAAAAGGGTTTAGATAAAGCACCATTTTTCTTTTTTGATGAAGATGAAGATTTGAGATTTTCAAATAAGTTAAGTAGCTTAAAGTCCTAAGATGAAACTCACTTAAACATAGATGATTAAAATATTTGGAATAAAAACTCATGTTTAAACCATAACAGTTCAGAAAAAAATTAATATAAACAAAATAATAATAAATTGGATTTTTTCAATATAAAACAACTAAACAATTAAAATATTTGGAATCAGGATCACGTTAATGAAACTGAATAAATAGATTTAAATTAAATGTTCTAAAAAAGGATTAAAAACTCTTAACAAAATAACTAGTGTTTTGGAGTTGATAGTGCATTTACAATAGATTATGAAAAATTAAGATATACTAGTTAAAACAGCAATAGGATAAGACACTACGAATTTAACTGTTTTAAGGATAAAGATTTACGTATAGATCAAAAATTCTAGAAAAAAATTTAAGAGCTAACTCTTGACGATGATAATCAAACAGACGACGAAACTCTTGATTATTATGTTGAAGTTTGTTTTAATGATTTGCTAGTAGGAATAGAAATGAATAAATCAGAATCATAAGAATTTTATGGAGAATCTGAAAGCAATTCTTCTTCATCTAATTCTCAAAACAGCTCAAAAAAAATGGACCCATTATGGAGATACTTCAGACCTCCAAACCATAGTGAAATTGTTGAAGCATGATAAACTAAATGAAATATTTCAAACAGCGCCATTTATTTTTCCTTAATATTTCATGAATTAAACATACATTAAATACTAATTGAGTTAAACATGATTGTTAACTAAGAAATTTTTCTTCCAATTCTCCCTAAATCTAATATATTTAATAATAATAATAATACTAATTAATATAACCTATATCATCAAATAATTCATCTAATAATCAAATAAGTAAGAGAAATTAATTTTTGGCTTAACATTTCTAAATTATATTTTAAAATAAATTTTGGCTCATATGTTGGAATTAGCTAATTAAAAAAGGATGGATACATTTGCATATTCTTTATTAATCTTATTTGTAAATTTATATTTATATTTGAAAAAAATTTGTATAAATATGCTCACTAAATTAAAAAATTTAATCATAAAATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1471.2 L-2378.5 L-3561.8 S-0108.4 S-3329.3
S-6188.9 S-9137.6 S-12102.0 S-15121.3 S-2487.4
C-084.1 C-219,374.0 C-414,669.7 C-624,910.6 C-821,136.4
C-108,147.2 C-124,092.1 C-143,658.7 C-165,251.9 C-182,934.8